Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C10H11.7   

sjj_C10H11.7RNAiJA:C10H11.7
PCR_productsjj_C10H11.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10H11.7 Source_evidenceePCR534WS150 Sequence/Annotation Release
Overlaps_Gene C10H11.7 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score Abs_score753
Max_abs_score753C10H11.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI47197344720884
Overlaps_transcriptC10H11.7 Source_evidenceePCR816WS150 Sequence/Annotation Release
WB_DNA_textsjj_C10H11.71151acagaagcttaagcgatgaaaaatttatcattcaaattaaacaacttaactggattaatttttcgaaacgatggctgctttcaatgatacacttcgtgcagaaattgaagagaagaaagaagactcagtttccgaaaggacaactcgaaatggaaaaatactgaatgcaaaggatgaaccagagtttggaatgaatattactccaaccacgttgttcttcaagtacccaattgggggaattggttattcattctttacagtcaccaacacaacatcggagaaacaagcattcaaggttagtaacatttgaattcaaaagttttagttagtcgagttgatattgtggaaatgaacgcataacttcgccaactactttatagcgcgaacagtcatgtacgagcatctcaaatatctgaaaaatctaaaagaagaacaatttgaaaggctatcctcctggaaatactgccaaccgtttgcagcgttgttccgaacttggaaatgaactcttaaatattgaaatattacaggtgaaatccagtgacaacacttggttccgttcaaaacccagcgtcggtttcattaaggtaagtgctcaccaaacattttgtctctctatatattttaatttcagagtggtgaaaaagttcatgtgagagtcacattcaatagtccagacgcaggaaaagaaagacccgaaagaggctcagacaacaaaaatcatgttgcaatcttccacgtggcagctggtgacgcgaagacgtacaaagaagcgtttgcgaagaaagcggcggacggagttcatcatttctttgcaagacatttggctgagccaggagcacaggttgataaagaagctgatgaaaaagcacctaatggggcttagaacatgaacttttatactgcatcaaataaaatgttttatcaactttccgtccaaaaataaaagtatagcagtatttgagctttttttttaattgaatgtttactatttgaaatgacacaaatgaaaaaatgttggccattttttttcgatattttgcaccgtcataaaaaatgttgaaacttttttgagaagtctcatcacaaaatgatttcttttgagcgcattttgggcctatacgcttaaaatgctcgttacttctcctctaacg