Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C10H11.8   

sjj_C10H11.8 RNAi JA:C10H11.8
Simmer:C10H11.8:Screen_A
Simmer:C10H11.8:Screen_B
PCR_productsjj_C10H11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10H11.8 Source_evidenceePCR718WS150 Sequence/Annotation Release
Overlaps_Gene C10H11.8 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score Abs_score657
Max_abs_score657C10H11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI47357954736662
Overlaps_transcriptC10H11.8 Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_C10H11.8868tgagcggttttatgtgaccatcccattgtgcgacctttttattgttctccacatcccagattttgacctgattgtcgtttccgccagtgaagatgtatctggaaatattgattgaacttttcaaaaattaatctttttgataacaaaattcttctggaatattcgactattttaattttttcaatttcaatagcttaccttccttcagaagagaaaatagcatcccaattccatccacactctgtctgcagggaacctttgatttccatagtttccgaattaaaaacataaacttctttttcagatccagatgcaacaatatattttccatcgggactataacgacacgatagaccatggccttctctcattttataatgtttatcctcatcacgaagacatccataggttccagtgtcttgttcaattggaacaattggagatttaaacatatcaaatgcactcgattcgacgacttctctcgtcatcaaatcccaacacagaagacgtcctttattcgtaattcctgttagtttctttcctgatggatgaactgccagcttttgtacgaattcctgcattttcagatcatctggcatcggaagtctcatgaaaatatgattgactacatcccaaacccagacatgagcagaattggttgaaacgaacaaatgtgtttgatgtgtgttcggaacgatgctggttactgtagatccgggaaacgagagaagtcgattcgcaactaattgattatttctcatttcccaaatacgacatactccgtcatcacctcctgtgtacatccaacgaccggcagcctggaaaattaaagaaattcttagtttattttcaagctgataggggatgc