Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C12C8.1   

sjj_C12C8.1RNAiJA:C12C8.1
PCR_productsjj_C12C8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC12C8.1 Source_evidenceePCR953WS150 Sequence/Annotation Release
Overlaps_Gene C12C8.1 Source_evidenceePCR953WS150 Sequence/Annotation Release
Chunk_score Abs_score911
Max_abs_score911C12C8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI93205469321559
Overlaps_transcriptC12C8.1 Source_evidenceePCR953WS150 Sequence/Annotation Release
WB_DNA_textsjj_C12C8.11014tttgtcctttgcttcaatttcatctttatccgctaatgtattacgttccatccaacgaagggtatcttcaactgcatcttttgcacgttttgcatcttctgctgataacagtgatccatgttcttcgagagcctgcttaacttggaatgcatacgcttctaattgattacgcgagctaattcgatctcgttgtgctgcgtcttctctttcaaactgttttgcttcattgaccattctatcaatatcagcttgagagagtcgtcccttctcattgcgaattgtaattctgtttgatctaccagttgatttatcggcagctgatacattgagaattccatttgcatcaatatcaaacgttacatcgacttgtggaactcctcgtggagctggtgggattccagttaattcaaatgttccaagacgatgattatctcgagtcatagcacgttctccttcgtatacttgaatagagacaccaggctgattgtctgcatacgttgtaaatgttttggaagctttggcaggaattctagtgtttctatcaatcaaattggtcattactcctccagctgtttcaattccatgacttagtgggacaacatcaacgagtaaaacatccttgatagtatcatcttttactccagaaagtacagctgcttgaacggctgcaccaaaggctactgcttcgtctggattaatggagcagttgaggtcctgaaaattgagatcattaaaagttactattttcatcattatctagagtaattattcttaccttcccattgaaaaactccttcagtagtttctgaatcttcggtatacgagttgatcccccaaccaagacaacttcatcgattctgcctttatcagtttttgcatcacgaagtgccttttcaaccggctccaaagtcttgcggaaaagatcagcacagagctcttcgaatcttgcacgtgtgattttcgaatagaaatcagttccatcaaataacgaatcgacctctacagttgcttcag