Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C12C8.3   

sjj_C12C8.3 RNAi JA:C12C8.3
Simmer:C12C8.3:Screen_A
Simmer:C12C8.3:Screen_B
PCR_productsjj_C12C8.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C12C8.3a Source_evidenceePCR1025WS150 Sequence/Annotation Release
C12C8.3b Source_evidenceePCR1025WS150 Sequence/Annotation Release
Overlaps_Gene C12C8.3 Source_evidenceePCR1025WS150 Sequence/Annotation Release
Chunk_score Abs_score962
Max_abs_score962C12C8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI93362189337334
Overlaps_transcript C12C8.3b Source_evidenceePCR1025WS150 Sequence/Annotation Release
C12C8.3a Source_evidenceePCR1025WS150 Sequence/Annotation Release
WB_DNA_textsjj_C12C8.31117ccaagtccaaatgagccaatgaatctcatatcatcagacgcaaagacttgaactcgattgttccgagagtcacatacaagtatatgtccctctggatcaatcacaactccttgtggacgaacgaacattccatcaccatctccttcacttccgtaaaccttcatctctgacatgtttctgggcgataggactgcgagtcggtgattgttgaagtcgctgaaagaattaaggtttttaaaggaaatattaatattttctcatacgtaatgagtaattgtccatctggcagatagcacaatccacgtggcgagtccaagttcttgaagaagtaggcggagtcaaatccacatttgcgaacgaattgtccctgtggtgtgaagatctgaacacgatgattccgagtatccgagacggctatcgcattatgagaattcgtggcaactccccatggatagttgaagtagccaacagcacgtccacgatctccaaacttgagaaggaacattccgttttcatcgaatacctggacacgatgattatctttatcagccaccacaatattgttcagagaattggtagttattccagcaggacgatcaaactgtcctggacgatttccactggttccgaactttgagatgaaatttccatctttgtcaaatatttgaacacgattgttgcttcgatcagcgacaataacacgtcctctctgatcaacacatattccccatggacgacataattctccgtcaccggatccttcttttccgaatgtcagaattggcccttttgctgcaatctcatcatagttcctgccacgtcgaatatccattgttgtcgggcatccactgattggagttcctttgacaagaatattcagtgtgtaggatccttcgatagatggataatacgagagtgcgacgattccattctcacggggtctgaaattttattgtgtttttttggaaatagtagtcaaatcatacgtcattgtgacctctacagttgatccatctggtgaaatgacaaaagcctgtacatcagaagttggcatagcttgttccaaatgggaatgtggttcttgatgaggaagaagtgcttgggatgttggttgagt