Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C14B4.2   

sjj_C14B4.2RNAiJA:C14B4.2
PCR_productsjj_C14B4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14B4.2 Source_evidenceePCR887WS150 Sequence/Annotation Release
Overlaps_Gene C14B4.2 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score843
Max_abs_score843C14B4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1934620119347783
Overlaps_transcriptC14B4.2 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_C14B4.21583ctacctacgcctctcggtatttttgtctgcatctctgtttgtctttccatctggctacctacctacctaacttcctacctacctacctacctgcctacctctacctacctgcctgcctacccacctacctacccacctacctatctaccaattttaaaactcaccgaatcagagccgtttccatcacatgaaccgacgaaaatggtgcaataaccgcagcggccgtcaatttacaggctatcaccaaacccggtgcaactggctgcttctcatcacccgaatcaatcgataaattcccatcgaccgtcaggctcccggcaacaatatccacctgtccctttaaagttgccaccgagacgcccacatacggcagcgaaatctgcatttcgttacaccgaatcagaccgtcaaatgtgcaggatttcagagttttgagcaaaatttcactggaaaccaggcggcctccgaagttctccgagcagtcttcatggagcacaatgttcatagagtatttcacaaaaattgtcccatcctcggattgttcgatggatcctgaaattggagagttttaagtgtgatttttggttttctgagctcaagagctttcatttaagccccatattgccttggtttcatgcaatttgaaattttggccgcgttgcggtcgcgtcgcggtcgcaacacagttttgcacttgtggctccaattggaacttagtgatgcctttgaaatgaggaaattatgattactgaaagtaagagctttcatttaaaccccatattgccttggtttcatgcaatttgaaagtttggccgcgttgcggtcgcgtcgcggtcgcaacacagttttgcacttgtggcttcaattggaacttagtggtgcttttaaagtgaggaaattatgattactgaaagtaagagctttcatttaagccccatattgccttggtttcatgcaatttgaaattttggccgcgtcgcggtcgcgtcgcggtcaccctcaaaatttcaaagttatccaaacctagtcgatatgggtgccaaaattttcctctcaaactcaggattccaattttccaactcaccagtcaccattttcaaatttttctccacctgccacagagcatcatttctaaagcatccggtgatgacgtcactgtccccgatcaccaagactttgccagtacacgtcgtgataagctcatttctcacataaatcgataaatcggtaaccgtcattgatcctccgacggtacagtaccccttacacgtgagacggagcacatgagcctcggttctcgagttgccgaaaaagtgggcggagtcttggagtaccaggtcaaattgctcggtgacatggcaaaatccgctgaataacagtgacagtgcagaaatgctcattgactcttctatgaaaatctttgcattttgaagaattgtgaggctccccgccacatggcaccaggcggaggtcaactgccacgtggcactcgtctcacaagctcctttgacttcaagctcgagtttttcagactcaatataagatccttccttgaaaattgcatttccaagagtttcaatgac