Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C14C10.3   

sjj_C14C10.3 RNAi JA:C14C10.3
Simmer:C14C10.3
PCR_productsjj_C14C10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14C10.3b Source_evidenceePCR1021WS150 Sequence/Annotation Release
Overlaps_Gene C14C10.3 Source_evidenceePCR1021WS150 Sequence/Annotation Release
Chunk_score Abs_score979
Max_abs_score979C14C10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1260026412601342
Overlaps_transcript (3)
WB_DNA_textsjj_C14C10.31079cattcgattcggacgaagttcccgcttatgtgcccactgagacgaggtttccagattattcatgattgaagagacttcacattctggggtgatgcttcggagagtgaaatgaataattatatcttctggaatctccgcgagaacatgtgatccacagctgaaaaataaattgaatggattactattttactttaaaaaaaaaagaaagcacttacaagtttcgaataattatttcagattcttcagagcagaggttttcaacaatgaatcttaaaacatcattgatccttacaatatcctggcgatttccagtgaacatccattcaggccacgtttgcaaagatttcaataatttatgaagttcatctactgccccatcagcgatcaaatcttcgagatgttctaaagaaaattcagtagctgtgtcgacgaaagaagtttcagttgatgaaatttggctggagatcgatggtaattcgccttctttccattgactggtgtaagtttccggtggcaacgagtccgggaacagcatatggccaatattttgatagttcagagattcgggtacgtgaaacagctgggcatctgattcattcacaggtgtagtagttgaaagatttagttttctttctcttctgatatgttcagacatcaattgtcttgaatctctgttttctttgctttgttgatcaatttttggcatcaagaaaggaagatttgtcacttctaacccagatgtacttggctcctgatcatcataatatgaagccggttcagaagaagatgtaagtacgtccaagtcagtagaagatgtgctcattgcgaggtcttcagcaatttcttctggaatcgcaccctccgaaagaagttctgaaacataatcgtatccaaaaatgtcatttgatccaccaagttctttggaagacacggtcgtaggaatttgaacgtttgagaatgcattcagtgtgtcattgcggaagagttgatcaagaaaattatgctcattgcctgcagaacttatcgactccaaagattgagatttcatagaaagaagaccaaaatcgtcgagggaaaaa