Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C14C10.4   

sjj_C14C10.4 RNAi JA:C14C10.4
Simmer:C14C10.4
PCR_productsjj_C14C10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C14C10.4 Source_evidenceePCR1142WS150 Sequence/Annotation Release
Chunk_score Abs_score1100
Max_abs_score1100C14C10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1259724712598434
Overlaps_transcript C14C10.4.1 Source_evidenceePCR1142WS150 Sequence/Annotation Release
C14C10.4.2 Source_evidenceePCR1142WS150 Sequence/Annotation Release
WB_DNA_textsjj_C14C10.41188tgatggagcaaacataacagatgcaacttttgcaatcaacgcagctttttcggatggtgatgcggttttgatcaaatgttgagctagttggcgtccaattgatcgtttcaggttaggattctgtccgaaaatgttacggatatctcctgcttgttgaacatgatcgaaaacgtctacgaataagggaacttgattcttagcacaaactgtgatgaggaattcgtttgctgaagtgataagccctttattttcagctagcgttacaactttcagataattttgaagatcatgggatgttgttatacttttgagttcttcctccagttgacgatttagtttttgaacaaagaatctgaaaataatgagtaaaataagctcctaacttctacaaaacttactcattggaatatgatggatgaatgcatgaataaagagcaattgcttcttcgagactcccttcactgagaagactttttgcgcgagcaacaacaggtaaattcaatttattgtctccaagagtagatcctgattcggcgacgatcaaataagacgaaagaagattaaaagcatcaaattgtccattttcaattagatccatgaaaacattgagtacgtatgcattattttcgagggaatgaagctttgcagttgtaggaatagctcttatcatttcggtaacttcaaaaccacctcttccttgctcgtttttttcgcgttctgcgatagctcttgctgcagcgcatcgtagacggacaacattcattgaagtagagaatgtatcaacaactcgaccaacatgttcatagtttcctcctctggcgactgaatagacaagttgggcgacgtgatcttctgtcaatggaattccactggacttcatgtgagagatgatgtctgtgatagcttttgtgtttgcttgtttcgcataaacttcgcataaaagagcataggattttccatcgagttcgataccagattcttcaaattttccaagctcttcaactgcatccacacgactgcgattatcaacttttgcttcgatcaactgatttcgagataagagacccaacacaactcctttttctcgtagaattgattcaactttctccaaattttgagcacgaagtgaacgggacaatgtgtcacaagttgagccgaagatcgataaaagaactgccaattgacgat