Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C15A11.1   

sjj_C15A11.1RNAiJA:C15A11.1
PCR_productsjj_C15A11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC15A11.1 Source_evidenceePCR912WS150 Sequence/Annotation Release
Overlaps_Gene C15A11.1 Source_evidenceePCR912WS150 Sequence/Annotation Release
Chunk_score Abs_score870
Max_abs_score870C15A11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73857637386960
Overlaps_transcriptC15A11.1 Source_evidenceePCR912WS150 Sequence/Annotation Release
WB_DNA_textsjj_C15A11.11198ggagcttatgtggttttgctatgattttttgtttcatgttatcaaatgtttacagctgaaaataataaaatcaatactgtttagcttgaagaaattttattgcaataaaattcatcacattccagaaaaatttaagttgattagaatcgagcacgacgacggacgacagcgcttccactgtatgttcctgtggctccatctccagctccagctcctgcatccggtgcaccaccggcagctccagagcttgcatccgcacctgtagcagcacctgctggagcttcttgggccaatcctgctgttcttggtgggcatggacaataggcggcgtcgactcctggtgctccatctgttcctggccctcctggcgctcctggagctcctgcttctccgtcttttcctggtgggcccggtggccccggtggtcctggtggggattctggagcagcagcgtcttctccagctggtccagctggtcctggaggtccagccggtccaggagatcccggttcgttggtacttgtagttcctgcggctcctggttgtccatttggtcctggtgctcctggctgcccatctggccccggtggtccggctggtcctgctggtccagcttctcctggtccagcagcatctccatcagctccaggagctcctgatggtccttctggtccagcatttccatctggtcccggtggccctggtggtccagcaggacatttgatacagttaccttcgactccaaggaaactatcagcaactcctgcagctccattctctccatcagttccagcggttccaggctctccaggcgctccatcttctcctggtgctcctggtggtcctgctggacaaccagttgattgagcagcacagttacattctctttctgtacctccgccggttgcatatccagcagctctctttgcaagaatatatcttccaaatgatggagacgttgcttgattctgaggaagattttctcgaaccattttattccaaacatcattggctcgagatttgaaatgaaccatttcgctgttgatattcatttcaaattgttgaatatcaagagaaattgagtaaagagtcagcaatgatgcgacaacgatcaacgagcagccgatcgtcgacgaaagaataaaataataggatgtactgtgggacattggataccaaatgagtgatgttttcttcc