Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C15A11.3   

sjj_C15A11.3 RNAi JA:C15A11.3
[cgc5655]:C15A11.3
PCR_productsjj_C15A11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C15A11.3 Source_evidenceePCR691WS150 Sequence/Annotation Release
Chunk_score Abs_score587
Max_abs_score587C15A11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73891507390335
Overlaps_transcript C15A11.3.1 Source_evidenceePCR691WS150 Sequence/Annotation Release
C15A11.3.2 Source_evidenceePCR691WS150 Sequence/Annotation Release
WB_DNA_textsjj_C15A11.31186gaaaaatgaggagaacggagtttggctagaagatatcgtgagcttgacccgactgatttgagatttctcttgagtgataaactgataatgtgcataaaatccggttgcatcaaagatgtcattcgttgagaaaatcattcgaaagtaattggattctgataatattggaccttttggagctgttttcccacaaaaacgacgattcgttcgatcatgagtctgatagtttgaaaatagaatataatcactttgagttgtttcgtcgcatctaaaaatgataattaatagcataatttttgaagtgttggaaattaagacaacaatacaggcttgtattcaaaatagatggttttttttttgaaaaattgttaaaatttttaatttaattttttctcacccttcgttaggtggtttaactaaaactaatgtttcataaactggtaggtaaatataacatgtttcatataaccaaaaacactcactggttaaaaccttcaatgtcgaaatattcaaaatgaatatgaacaacttgatcatttcttccatggaatatatattcacaatataaatttctcggatacaatcctggatagtttgcagaccaaagtttcccatttgtgtgctctgatgaattgaatgagaagcgacattctgtcaataaaagattttacagaattaatacaaaatgtgatcaaacctttctttttatctacttttgctttcatatttcccatattccagtcagtatgaaatttgtaatctaatcgaaaaccaatatcatcatttgtgctttctcgaatagcctttgatgactgaaattatgaaaataaaaacgatctaaattatcaagttttttaaaagtagccttttgttttttgctagataacgtttgaaatctttcataacttggttgaacttgctctagagcagcttcatttttagagttcaatcttgatagaatcaaaaactttactggtaaaattgcaaattaattcaacactaacctttgtattatattccaattgtagaagatttgaactactcatcaaattgggtggagctcgtttaccacaccattcatcaattcttgaaagacgtgaccccactcgaacatcagcagacagattatccacttctgtgcaactgaaaaaaatgaacaattttccagggtagatctcggttttat