Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C15A11.6   

sjj_C15A11.6RNAiJA:C15A11.6
PCR_productsjj_C15A11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC15A11.6 Source_evidenceePCR951WS150 Sequence/Annotation Release
Overlaps_Gene C15A11.6 Source_evidenceePCR951WS150 Sequence/Annotation Release
Chunk_score Abs_score888
Max_abs_score888C15A11.6
Specificity_index0.511
Rel_score1
Map_statusUnique_ePCRI74032087404393
C15A11.5 Chunk_score Abs_score851
Specificity_index0.489
Rel_score0.958
Overlaps_transcriptC15A11.6 Source_evidenceePCR951WS150 Sequence/Annotation Release
WB_DNA_textsjj_C15A11.61186tcaaacgtcttttcattgtcaaagtgataagttgatttctactgtttgtcctcttgatataatgcaaaaaaatgaaattgttttaaagaaacttttattggaaagagtctatagaataaatatataattttaagcttgaacatgacgtctagctgcaaccacacgcttctttgcaacacgcttcttggcaacaacacgcttctttgaagcagctgcacgatgacggttgacattacgatgacgaagaacagaactacgagttgggcaaggacaataagcagcatcggatcctggtgttccatcatttcctggtgctcctggctgtccatcttgtcctggatgtcctggttgtccatttggtcctgctggccctggtggtccagctggtcctggagcattcccgcttcctggttgacctggggctcctggtggtccttgtgatcctggtgcacccgatggtcctggaagaccgcgtccacgttgtccagattttcctgggctaccaggatttcctggagctccggcctgtcctggtgatccagcacttccagctggccctggaggtcctggtggtccctgacctccaccttgtgctggggctcctggatttccatttggtccctttggtccaggttgtcctggagctccagctggtcctggaagtccttgtggacatttgatgcattcttgtttctgatgatgagatggcccagcaacaccaggctgtcctggttttccagcttgtcctggttgtccatcatgccccttatctcctgatgctcctggtggtcctggtggtccagctggacaattggatgcttgttgaccacaattgcattgagattgcttcttttgacgacgacgaccaaagacgctacgagccatacggacagaatcatcctggtttatcattgagttccaagcatcattggcaaagcccttcaaaattcaattaagcaaaatgtatttttttcaaactttaatttaataaaaaactaaccttgaactctcccaattcgcgatgactgtcttcaacaaacgaattaatgtcggaataaatatggaagacagagatcaatgctccaaataccacaattccggataaaccggccataaccgaaagaaacattgctgaagacattctaccaggtgaatgactgtgttccaacaattttcagtcactcct