Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C15H9.6   

sjj_C15H9.6RNAiSimmer:C15H9.6
PCR_productsjj_C15H9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C15H9.6 Source_evidenceePCR892WS150 Sequence/Annotation Release
Chunk_score Abs_score829
Max_abs_score829C15H9.6
Specificity_index0.912
Rel_score1
Map_statusUnique_ePCRX60905356091710
F26D10.3 Chunk_score Abs_score80
Specificity_index0.088
Rel_score0.097
Overlaps_transcript C15H9.6.2 Source_evidenceePCR892WS150 Sequence/Annotation Release
C15H9.6.1 Source_evidenceePCR892WS150 Sequence/Annotation Release
C15H9.6.3 Source_evidenceePCR892WS150 Sequence/Annotation Release
WB_DNA_textsjj_C15H9.61176ctttgccttctcgacctcacgacgaagcttttgaacggcacgcttgtctttgcggagatcctttccagacttcttcttgtaaagcttgatgaagtattccatgacacgttggtcaaagtcttctcctcccaagtgagtgtctccgttggtggccaaaacttcgaagactccgttgtcaatggtgagcatggatacatcgaaagtaccacctccaagatcgaagacgaggatgttgcgttctcctgtaaatgaaagacattcatgattggaagaattattttgtttcaaatctgcagtcaaccctctatacttaatctgtgatttggtacagcttcggacctgagcaaacattcctattcctcattcctaacgagagaggaacctgtaccagtcactgacccaaaatctattgtttacacaaaacggtcaaaagggtagtccagagacaaatattagagagcacttttctcataaactcaccgtccttcttgtcaagtccgtaggcgatggcggcggcggttggctcgttgatgatacgaacaacgttcaatccagcgatggttccggcatccttggtagcttgacgttgggcgtcgttgaaataagctgggacagtgacgacggcgttcttgacttcctttccaaggtaggactcggcgatctccttcatcttgacgagaaccatagcggaaacttcttctggggtgaattgcttgttgtcggatccaaccttgacttcgacggatggcttgttgctcttgtcaataaccttgaatggccagtgcttgatgtcagcttgaacagtcttgtcgttgtaatctcttccgataagacgcttggcatcaaagattgtgttttctgggttgatggtgagctgattcttagcagcatctccgatcagacgatctccttgatctccagagaaagcaacgtaggatggggtgatacggtttcctgaaaatgatgggttataatttacgtttatttttcgttcacataccttggtcgttggcaatgatttcaacacgtccgttcttgtaaactccgacacacgagtaggtggttccgagatcgataccaataatggttccatacttggtctccttcttctcggttttttcctcttcctcgcagtagacactgacggcggatagggcgatcaagcccaacaagaat