Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C16C4.10   

sjj_C16C4.10RNAiJA:C16C4.10
PCR_productsjj_C16C4.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16C4.10 Source_evidenceePCR825WS150 Sequence/Annotation Release
Overlaps_Gene C16C4.10 Source_evidenceePCR825WS150 Sequence/Annotation Release
Chunk_score Abs_score720
Max_abs_score720C16C4.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII18816371883168
Overlaps_transcriptC16C4.10 Source_evidenceePCR825WS150 Sequence/Annotation Release
WB_DNA_textsjj_C16C4.101532ccaggaccaacttgtttgctcttcacatcctgtcattttggtgatcttgacgagagctccaatgattacactgtcgttcaccatatacttattttccatatcatcccatctaataaacttgcaatagccgtaacttattggcttttcaaaagtggatgttcctttgatagataaactctggccattcagagacaccaatcttagatcatattccacttcaattgtccagttccttctattggatagttctttttcacatcgcaaatatagtccaaaaaattcattgaatctttgaatttgtagtctccttaataaaataataaataaaagtcagtttctttgaacaacaaaccatggaatattgaatcttttctctgtatttgtgaaatagttacctccttctttaatacttgaaacatttttaacagtgtgatgcaacagaaatattttctgattttcgttttcaatgcacggagagtctgaatttattaatatttttcatttcacaggtatcgttggaaattcgcgttttcaagagttttcgtcttaatcttttgcaatttttatttttgattttttgtggtattcctgaatattccaagtgttataagactaaatcctttttttcaaaccaccattagttgaattggagagtaaaaagtttttttcaaattgttcaattttcgtctaacatttttcaattttcctctaaaaaatgaaattcgaactcacaggttattttaattattttgacatgagcttcaacaacaatactatcatcaaccccgtaatcacactctaattctttccaacggatgaattcagaccaaccacgttcttccggtttttcaaacgtgtaattgtctgtttttgtcaaacgttttccattacatgaaatcaatttcaatgtaaactcagtttcaattgaccattttctgttttcacattcttccttttcgcatctcaaataaaactcaaaatatccattctttttccatattctcattctcctgaaacaaactttacatgattattcaggtgcatttagatttaccaaccatggaatattgaatcgttcttccgtgttagtgaagtaatactcttcagcaacaaatcgtgaaatatttttaatatgttcgcttatcacaaactctttgcaggaattggtcattgttctgaaataataatcataaaaaggaactagtacaaacgaattgggattatttaataaagagtatatactgaaaattaaataaatagtttgactaaaaaagtgttttggttaatagaaattataaattaaaactagcaatatgatcaattttcacacaaaaaacgtcacagagtttgtctgaagaaacagatacaaggtggtgagttaaaaaggagttcttatcagttgaacaattattcctaacatgaagaaagtgtcaacttgatgggagaaaatgaggaatttgtactttctgcttaaaagtggagtaccaaaatatagagactttgtttttttagatcgaaaataacccacgtgc