Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17D12.2   

sjj_C17D12.2RNAiJA:C17D12.2
PCR_productsjj_C17D12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17D12.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
Overlaps_Gene C17D12.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
Chunk_score Abs_score833
Max_abs_score833C17D12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1159699111599230
Overlaps_transcriptC17D12.2 Source_evidenceePCR917WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17D12.22240aaaagacaaaatggacgacaagaagcttttcatcggaatgctctcaaaacaacagtctgaagatgaagttcgtgctcttttcgccacgtttggagagcttgatgaggtacgtgctcggtgagcccttgtgtcttccggaaagccgtgtgctacgagaaaaatgatgaatgaggggtagtttgggcgaaaagcttgacatatccggctcaagaaaaactggggggaattttttaccaaaaccatttgttccccatattctccaaataaagaattataattttcaggtaactgtgctccgtggagccgatggagcatccaaagggtgtgcatttgtgaaatacaagcacggcctggacgctcacatggcaatatcagctcttcatggctcacaaactatgcccggagccagctcaagtcttgtggtcaaatacgcggacactgagaaggagcgtcaaaatcggcgaatgcaacagatggctgcacaaatgggaatgttaaatccgatgcttgtgaatcaagttggcatgcaatataatgcatatcagcaggttctacagcaacaatcacttgctgcacagaccaatgcgatggctagtgcggcttacttgccacttttacagcagcagactacggtaggttgagattcaggagttgaaaattggatagttggattcagttcgccgagagctttcaaataagtataatcatgcctaggttttggaaaatttgtcaagtgacaatttgacaacttgacaattgacaattgacaattttccaaaaaattaccatttaaaaacaagagagttcagctcaccaaaagctttcaaaaaagtataatcatggctaggttttggaaaattgacaatgtggcaaatgacaattgacaattgacaatttgttctgaaaatgacaattttaaaacaatagcgttcagctcaccaagggctgtttgaaaagtataatcatgtcttattttggaaaaaatttcaagtgacaattgacattttgacaacttgacaattgacaatttttccaaacctaggcatgattatacttaaattgaagctggaaacttggtaaattcaaatttgtgtactagaacctgctcagattgattgttttcaggatcccctccacgttctgcaacttcaggctgccgccgcagcagcccaggcagcagcaaacccagttttatcccaacaaactcaacagcaacaacaacagcaacaacaactggccgcacagcttcaacttcaatccgcagcagctcagaatccacattacgccctagcagctcaagctctggctcaacaacaggctgctcagcaggctcaggcagtggtggctcattctcatgcacaagtacatcagcaccagactgctcaggtgacatcgacggcttcacatgctcagactgagaatcctgccgcgagtagctatggaagcttggcggctgcggctgctgcagcaaactatagcagtttgttaagtgggatggaaagccagcacagtgagttgttgaaatttgaattcagctccgtgagagctttcatttaagtataatcatgactaggttctgagaaaatggtcatttgtcatgacaagttgacaattgatatgtggcaatttgacaaacgtatgaattgcggacttttatgagtggggtttgaaccatctttggcgatcaggttcagtgagcattttatgaaaaattatgtgaaaattgtcatttgtcacttgtcaattgtcaaattgtcatctgacaaatttccccaaacctaggcatgattatacttaaatgaaagctctcaatgagccaaatctcgtaaaatggataaaatttctcccaactcagaaaatgagaattttagacgccgccgccgccctgcaactcgcccaaatccagcaacaagccgctgcagcactgccaatggtgacacccagagaaggtgagactttcagacaatttacttacagaatttacttataggccagttttctttgttttgcaaatcattattttttcgtgaaaaacctgtgaaattttatctgtgccgaaaatatattcgatcgattgttgtgcggtcatcacatatcttttttcatattttttattttatttttccatattctgatttctctcaatattttttctcactcccttctcaatttgacgcttgtgatggtagttgtacaggtggaatatttgagagattgtggttgaagaagtcgtgaaattt