Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17D12.3   

sjj_C17D12.3RNAiJA:C17D12.3
PCR_productsjj_C17D12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score577
Max_abs_score577C17D12.3
Specificity_index0.5
Map_statusBest_ePCRI1161887811620568
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score577
Max_abs_score577Y47H9A.1
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRI1162278611624476
Overlaps_transcript C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17D12.31691cgcgaacaattttaccgattggattgatattctgaaatttccaacaaaaaaaatgtgcaagccacaatttgccgaaatttttggcacttgctgtttttccggcaaattcggcaaatcggcaatttgccggaaattttaaactccagcaatttgccgatttgcggatttgccggtttgccggaaattttcactttcggaaattttcaattccggcaatttatcgatttaaactaattatctccttcttgaccttgggtcacttcaaagtttttacaaaccaaacctgactatttttagagacacatttcaaaaaactaatgtcatcgcaaaatcctgtatactctccactgccgctgagcggaacaaacatgtaagtttttttataataatttaaactaagtttagcacttctccgtaagaaatttagcaaatttaagatcgcaagcggaagcaagatcgcatccttctaaaaagatcgtagctttggtcctcgttggaactctcttttttttattttctttttttttagcggttgcacttttcgggggctcttcaactgattctggtaagagttttagttttaccctctaaaatcctatgataactcccgattttcagatctagagcctgaccatcagacattaacaacacagaacgaacctatccaattgggaaatcatagatactttgcgttcaagtacgaaattgtgcgcggaaagtattcgcacactaacaaagatggatcagcggttaaaccatttatcgtgaaaaatgttgaacggcattctgatgaagaaccatacgatgtatacttgcaaaagaaaaaacgtaatgaggaaggaatggtatgtttgagtttcacaaacgtagacttattgggttttagttctactggaaattacaactacagtaccactacttaacctacagtaccccaacgacactcctacaatactcctacaatactcctacagtacccctacagtacccctacagtacccctacagtacccctacagtattacaacagtactcctacagtactcatacagtatcccttacattacctctaaactacttctaaactatcactccagtagctctacagtaccctacagtaccccaacggccctcctacagtatccctatagtattccaacagttctcctgcagaatcccttacaatacctctatagtaccaataaagtaccactacagtatcactactgtaacctaaagtaccactacagtaccgctacattacccctatagtattcgttttagatctactggaagttcaacttgacgtctactggtaaagtattggagacgctggtaattcgaatggtaggaataaatcagacactcaacggaggaggaaaagccgaggcttgtctggacacttttgaggttgttatgaagaatcttttgaagtgctacagtcaccaataaattttcagaattgcatggaaattccggtaaaccaggatttgatcattgataagccacaagctgacacccttttcttaggagttggtgattcttatagctactacatagctagtaaacatcaatttcagatcaagatgtacaagaatatgaaagtatttgggcatgctgaaaagtgtatggaatgtagggagcttgagagcggttttttggttaaagcctactggggtgagtttgaagcat