Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17E4.1   

sjj_C17E4.1RNAiJA:C17E4.1
PCR_productsjj_C17E4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17E4.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
Overlaps_Gene C17E4.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
Chunk_score Abs_score638
Max_abs_score638C17E4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94090119410196
Overlaps_transcriptC17E4.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17E4.11186aaaatggaggccttctcgataatttctgtcatcctctgatctcccttgacatcaaccacttccacgtcaattttccaacgcattttattttttattccttttgaaccagtttgtactggggctgatggaccttctatttcctgaaaaaaaactataacaatattctctccatttttcagtacctcaaaggcgctaccgtctagcacctctttctttgactcttcttttaatgctttcttcttttcaaatacagatggtggtgcatttttctgaacatcagcttgcggaactcccaaatcacttttcactttttcatatttcttctcttctcgtttcgtttcaacttgatttttccgatttgcagaaggtcgtttcacgattttttgttgctcaatttcagttgtgctcttctggttctagaattaatttttaaaaatgagaaaattattgattttttagtttttcgtgaaaaaaggctcccgtgtaggcaccaaaaggcctgcctgcctcatcttaaggtgacctctgctagcctcgtgccttattttaaaatacttctgtcgttaccgtcttcgtctttgacttttcgagcactggagacacgggagccgcacttggggatggagtttttgctgtttctgctgtttctggttcctttcgactatctggtgatttggtacgaccactgcaaagtttcaattataaaatcgagcgaaaccatcattacagtaccgtgacattttcgcgtaaaatgtaatgcctcaagttaatgcatctcaccttacgctgaaatcgactgatctactcgcgcgggaactcacgtcaagaatttcacccattttggaagctttgtctttgattttggtttgtccattttttaatctgaaaatactttttttcaatgatcatgtctgaaagaaactcacttcaaaacaatgtaatgcgtaaataagttttgtccgttttgtagcgactttataaaaataggaataaatgcattgaacaagaatactcttcgataaaaaaaagaggttcgtggagaatggaattcacgttcactttttgataaaaacattctttattgtggagtattaattttttggtgtttagaggcatgttagataccttcaggcctacgtgtatgcccaccaacgccctatttgtttgcgttggggagtgaaattaa