Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17E4.2   

sjj_C17E4.2RNAiJA:C17E4.2
PCR_productsjj_C17E4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17E4.2 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene C17E4.2 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score824
Max_abs_score824C17E4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94156529416642
Overlaps_transcriptC17E4.2 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17E4.2991gacgctgactcagtggtgaaaacaatgcaggatatgatgaagctattgatagaatctgaaaaaaaattctccatggtgacgaagcaattaagcatggttcaacaaaacagagaatctctaaacgagaaattgactgtggcacgtgagaatgtgaaatcggaagctgcaatgaaatcacacttggaacagaaatataaacgtttgacgctgaaaatgaaaaacttggaggctgccatgacgttgaagctcgaattagagagtttaaaagttttcgaggagacgaagaaagtgaataatttggaagagacacttaacgagatagtgaatgagcatctccagatacaagaaaatcatagagcagcaaatgcacaaattaataaattggttgatgagaactcccaaatcgttcataaattggaacagatcgtggcaaagaatattaatcttgaaaaggtaagaatctttaaattcgaaattccaatctttcacaattattatcattttagaaatccgccgagctaaatgagaagatgtctgccctcaataaaataaacatagaactgatgacatcagagagactccaatgcgagaagagattaattgtacaggataagctggtcagtcaaatggaaaagaactctgagctacaggatgaagtgaagtctctcaatttgagaatcgagaatctcggagttgaagagctggaggatgtgggagaggatccgagtgttgaacaaatccaagagagtgcatcagctgaagatcacgaaacaagatctgaaagcagcacgagttcaactagttcattcgagccaatcgatgacgatttcagttggtattactaaaattatttattcttaaacacgttaaaaattgttattgttcatatcatgttgaaattctatttgaaacccaaaaattcctaataccgccattaccttattctatcaagtacaaaatctacctccaactttcgtccttcgtgtcttcc