Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17E4.4   

sjj_C17E4.4RNAiJA:C17E4.4
PCR_productsjj_C17E4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C17E4.11 Source_evidenceePCR316WS150 Sequence/Annotation Release
C17E4.4 Source_evidenceePCR378WS150 Sequence/Annotation Release
Overlaps_Gene C17E4.11 Source_evidenceePCR380WS150 Sequence/Annotation Release
Chunk_score Abs_score380
Max_abs_score380C17E4.11
Specificity_index0.564
Rel_score1
Map_statusBest_ePCRI94191919420367
C17E4.4 Source_evidenceePCR378WS150 Sequence/Annotation Release
Chunk_score Abs_score294
Specificity_index0.436
Rel_score0.774
Map_statusTop85_percentile_ePCRI94191919420367
Overlaps_transcript C17E4.11 Source_evidenceePCR380WS150 Sequence/Annotation Release
C17E4.4 Source_evidenceePCR378WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17E4.41177aacaaatgggagcttctcaaagtgtaaatttcactaaatttctgaatatttgtactgaaaagggaaatttgcaatacttcagaatgaaaaaaagaagcaaaaacaatgaaatttcttgaaaaagttaaaagattgcgccggtgatcgtactgtagtttttaaaggcacacaactccccacagtagggtctcgtcccgacagacagtttttcgaatttacaaggtttttcttttttttataatcgaaagagatttttctagcaactcctcttgtattatatttcctaaaatggttcttccaactgaaattccaccaataaatcaatcaagtgttctaattgatctcaaaaagcgaacaactagctcaatagaagccgtaagtttcagaattctaaactgctgacccattaatgtcgaaattttacagaaggaagatccaatgaacaccgcattctacgaacctgaagactttgaagccgaaattgagctgtatgttaatgcttttttctcagaacattaatattattcagatgcatcagtaagcgtacaattcaagaaaagaaatcagattattgggaggataaactcgattcattcaataaaaaacatccatttctgatgctccactttgctccagtggtcttccagctttttctgattgccctcaccacactgtttctgaacaaagcaggggtcacagattctattgataagctagctgcacatctgtactattttctattctgtgtcattttttaaacgtttatataactattagaaaataaaattttatttattgcataacagtaataacaaaaaagtatcagaaattcaacaacacggaaattaggagaagaagtttctaaatgggtcttaaccaagactttgcaattgaactatatctgtcggctagctccttgttcaaactgtttccctttcggcacacgtacacataataatggaacgtgtctccaaattcaaacatctccaccgaccaatttttctctcgaagtaatgcaggaatccggaaatgtggctgtgtgaatgaaactgatatgaaaattccatttggtttcagaactcgacagatcgatgaaaaaatgttctcgagattgtgaagagccgagtctgacggttcccatgcacttttttcagtcaccaaaatagcttcgattgtt