Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17E4.9   

sjj_C17E4.9 RNAi (3)
PCR_productsjj_C17E4.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17E4.9 Source_evidenceePCR783WS150 Sequence/Annotation Release
Overlaps_Gene C17E4.9 Source_evidenceePCR825WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI94312569432344
Overlaps_transcriptC17E4.9 Source_evidenceePCR825WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17E4.91089tgctgtcgagtgtgtcttccgaactcgaaccgaatcatcagtaagtatattgtacgagaataattatcactaatctaatcattataagaaatggagaaaaaggtcgacgagaatgccacccttatgaacggggtggaaaccactggaccggcccgtgatgatgtgccggaaacgttcagagaatttctctacaacaagaaaaatggaaccgttatgggtagaaccggaaagtcttggttccaggtaatattttcaaactctaaatttaatttactcaaaaaatattttttaaactatttttgaaatttcagatcatcgtcttctacatcatcttctacgcattcttggccgccttctggttgacatgcttgaccatcttcatgaagacacttgatccaaaagtaccaagattctatggaaaaggaaccatcattggagtgaatccaggagtcggatatcagccatggttgaaggaacggccagattcgacactgataaaatacaatctccgtgatcaaaaatcatacaaagcatatttggaacagatgaagacgtatttgacgaaatacgattcaaatgccactgagactcgtgagtgtggagccggagatagcaatgatgatcttgagaaaaatccagtaagtttcaaattttttgactttcgtttcactctgagtattattcaattctatgattgatttttcaggatgctcttccttgccgtttcgatctctcagttttcgataaaggttgtagtgagaaatccgatttcggatacaagtctggaaagccatgcgtcattatttctttgaatcgtctcatcggatggcgtccaactgattatcaagagaattccgtgccagaagaagtaaaagaccgttacaaggctggatcgattgctataaattgccgaggagctacaaatgtcgatcaggaacacattggaaaagttacctacatgccatcaaatggaattgacggacgctattatccatacgttttcaccaaggtttgttcagttttcattggaaatatttttattttttaaatataaactgtttcttctttagtttcacaaaagggaagcca