Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17G10.2   

sjj_C17G10.2 RNAi JA:C17G10.2
Simmer:C17G10.2
PCR_productsjj_C17G10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17G10.2 Source_evidenceePCR834WS150 Sequence/Annotation Release
Overlaps_Gene C17G10.2 Source_evidenceePCR853WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769C17G10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII55952865596373
Overlaps_transcriptC17G10.2 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17G10.21088caaaaacatctcggtaatcttcgatctgcaattaaagactgctcgatgggacggaagtttgatccaactcatctgaaaggtgtaattcgaggagccgaatgtcttctggaattggaatatgcaaaagacgcgctgaattggattgaaagcagcaaaaagattttcgcattcacgaaagaaacttctgacactcgtatgttcaattttgatttaaaaaaaagttaaattttcacaattttattttacagcggatcttactgatgatgagaaaaaattcatagatcaattggaaacacttcgagtaaaatcagttgaactgtcattgaaagaagaaagagataaaagaaaatcaagagccgaagaaagaaaagagacagaatcgaagaaacaactattagatgcactcaaggaacggaatttgaatttatgtccccgcgttccgtttgatcgtcccgaactcatggatatggcgagacttaccgtatcccttccgttgatgcattcagtaagtttaatttattctgaaactttgagtttctctaattttctacatttcagcatgaatgtgtcaaattcgatgatgatctaaatcttgtatggccgatccttctacaatatcccgaagctggtcaaactgatgttcttaccgagacaaatgaattaacaaccgtcggagaattgttaaaagaagtgttaaattcaccagctcagtgggatccggagcacaaattcaattttgagaatgttcggttcttcgtatcggatgaatatgatgaatatttgatggaagtgtacgaatggaatgatttcaaatcggtgcttagcatgccaggatatcaaataaaacaggggcttcctgtaattatggtgagtttttccacaaaacgctgaattatgggtttatcatttccaaaattgttaaaataaaataattcgacaatttttcagattatgaccaaagaaaaagccgcaagttccctagaagcattggctgaggatgagaatcgatacgttgctaaataaaattgttgtcatttgattacaaattctgttattttacttcatcccgttgttttgttgtgttattt