Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C18D1.1   

sjj_C18D1.1 RNAi JA:C18D1.1
Simmer:C18D1.1
PCR_productsjj_C18D1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C18D1.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681C18D1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1006291210063981
Overlaps_transcript C18D1.1.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
C18D1.1.2 Source_evidenceePCR743WS150 Sequence/Annotation Release
WB_DNA_textsjj_C18D1.11070tgttgcctgagctgattacgagttttgaacatagttcggcaagtgtcacatcggaaagtaagctctccttctcgctccttgatgcttgtgtcgatatttgcaataactgtcttgttctcatcaatcacaattccgtgcattttgagcatatgtgtacggaggaagtacttgttgcaaacttccttgttgcaaatatcacagaagtttttgttgttggaagagtattgacgtttgactccacttcccttgtttggctgaaaattttgcattttaaaaaggaaatttcaatgtaccgattgaaaagaaactgaaactcactgtggacaaagctgacaatggctcaaagtcttgcattccagcaaattgttggtggagaggagactggaacatcagtggaataccagctaatccttgtggaaagagaccactgaacatcatagattcatctttcatctgcttctgattctgctgatgaagcgggtttgaaagacccatttgagcgagaagtgattgcatgagttgattatttgaagttggtgtcaatggagtttcatctccagtcctctgtttcttggctgatggttgctgagtgacatcatcatcatctgtatttgattgagaattcgaatgcccattgacgattactgtagatggagctgagtcaactgaagatgtcgtgctagcagcactacattccgtagctgttgaggtggtcggaaataccatggatgccagtgttgagttcagagaaacagctggtggtgggcttggagaggattctcgttgttcttctggctcctgatcaacctgaaattggcttatttcttcaagtggcaaattcaaatggggaatttaaaaattacaactattttcgaattttgataacgataacaagcgaaatccagcattatctgtcaagatccgtttaggaataatttaataaatagattggcttccacctctactatttatagctttttgaaaagatgggatccaaaataaagaaaaaaacgttggataataaacgaaatagagaattctaaaattggtgcccactcaaatctgcaaat