Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C18E3.1   

sjj_C18E3.1RNAiJA:C18E3.1
PCR_productsjj_C18E3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18E3.1 Source_evidenceePCR733WS150 Sequence/Annotation Release
Overlaps_Gene C18E3.1 Source_evidenceePCR733WS150 Sequence/Annotation Release
Chunk_score Abs_score649
Max_abs_score649C18E3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42130124214153
Overlaps_transcriptC18E3.1 Source_evidenceePCR733WS150 Sequence/Annotation Release
WB_DNA_textsjj_C18E3.11142aaacgccaagaatcatcgtcaattcatttggatagatccaaaatgcgaaaagctgttcatcaggatctgtgcacacacgatcagaagatcttggagcccttgtttctgagaaagtgtgaaccgcatcgagtccgacagggcacagcgccgcctaatgttattccgattcaaaaagtggaaaacgtggaggctaataaggtttgtgatgatgagttgttgtgccacgtggaatttgaaatcgagatgcacccgcgctcgacggtcaaatgaaaacgatccgcccccaaacgttgggtctcgttaggaactgctggcaaaactgtaaattcaaatgtttcttttacattcgacgtgaaaaatttaacgaaaaatccttgaaaattggtgaaacgaattgaaaatgtttaaattatggccaatacctaacgagacccaacgttttgggggcggagcgtttttatttggccatagagcgcgcgcccctataataaaaaccaattgatttttcagaaattcactggccattctgcacttctcgtcagtctcaacaccccgacctactgtgtccgctacctggccgccaatgcagttcacactccgaaaaatgtgctgatcttcgcttcaccactgtcctatgtgcgatttgttgctcgccccgatccacagagaacaaatgtaatcgtttcggaaattaaaaaaatgtagacctaattttttttccagcaatcagttttcgaagatccatctgaaacggttcggcttatgatggctcctgacgtggcaaaagtcgctcagaaaatgcttcccaaatggcaaactgtcactttcacattggcattcggaaagcatgtggctgtgaagtaccggatcattgaagttcgcaagcaacctgtcacctacgtcaaagctaaagctgatcgtgtgaagcgcgtgtcgacaagtactctttaccgtaccgagccagtgcaggtgagttgtgtgaattctaatttcaagggtttacaattttatattttagagagtcgactattggcgcagtttcaagtcaaatgagctgaagctctcgactgttgagaagaatgatccgcaaatagtgaaacgtgtgtttctcgagcaacaaagtttgaattgggacccttctg