Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C18E3.3   

sjj_C18E3.3RNAiJA:C18E3.3
PCR_productsjj_C18E3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18E3.3 Source_evidenceePCR1039WS150 Sequence/Annotation Release
Overlaps_Gene C18E3.3 Source_evidenceePCR1039WS150 Sequence/Annotation Release
Chunk_score Abs_score976
Max_abs_score976C18E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42058934207473
Overlaps_transcriptC18E3.3 Source_evidenceePCR1039WS150 Sequence/Annotation Release
WB_DNA_textsjj_C18E3.31581aagagcctcgtccaatctcaattttcaacaatccacgattgaactctggagatgaagattctactagaaattcaccttccagtgttatttctccaccaacttccgtttttacaatgtccccaattcatgaagcacactctcaggttacatacgacagtattgctccactggaaagtcctgctatcgactctgatgacgattttgactttttcccatctttggtcgagacaagctcgcgaccagcgtcttccgaattgaaagacacggaagagtgcttggacaattctcagagcatggaaaaatatggatatattgattctgaaaataattatcttgaaatggaacaagaagatacatcgaattcagaagaagatcagctcgaaattgctgattcaccatcttctacaatctcatctgcacatggaagttatgatacagatcttatcgatatagaggacagctcagctcatgaaacgatcctaccagatcaggaaaaagaagaagatgctgaaataatttcaaccactcaaaactttagtcaagtccttcatgttgctgagactacaacaccaggtaaatttatagcttccataatccataatgagtggctaaaactcagtgcattaagatatatcagctagtttcagaattctgctaatttttttattttaattattccctttctcaaattgtactaaacatcgataataattaataagtattcttaattaatatttacggtgagctttgttgttaaattttgaaattgattcacttgggggtggacggcaaattaccggttttccgatttgccggaagttttggttttcggcaaattgccggttttccgatttgccggaagttttggttttcggcaaattgccggttttccgattcgccgaaagtttaaatattcggcaaattgtcggtttttcgatttgacggaaattttaatatgggcagattgccgattttccggaaaaaaatcgtttgccgcccatccctggttcaactgttgaatttgaattttatttaaaaattgatgtaatgtttgttttgttcagatcacgttgaagaagtttctttgaaggctacaaacaatgtaccggaacgagctccattcactatgtactctacaaagaatcagttagaacatctctcaactcccgaatacccaactgcaagacggatttctcttcaattcaagccactgaagatttcgaatcaaaaacctgatattttcaaacagtatcacttgccaacaatgaaagaacttgagcatcttccgaagcagttgcggtatatgagtagatcaaataaaactgataacagatattggtttgatgtcggtactgtgaagaatgactttaaacggaaacttttcggagactattaccgcgattggatgcgttccggccattttatgagacataaagtgaatagtgtatgttcacaattggatgcaaattgtccttacttcattctaaaggaagaaacaagagataggtataatagctttggttttggaattttgaattttctaagatctattttcagcccagcactgatgctccaaattga