Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C18E3.6   

sjj_C18E3.6RNAiJA:C18E3.6
PCR_productsjj_C18E3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18E3.6 Source_evidenceePCR1029WS150 Sequence/Annotation Release
Overlaps_Gene C18E3.6 Source_evidenceePCR1029WS150 Sequence/Annotation Release
Chunk_score Abs_score945
Max_abs_score945C18E3.6
Specificity_index0.828
Rel_score1
Map_statusUnique_ePCRI41900954192327
Y65B4A.4 Chunk_score Abs_score196
Specificity_index0.172
Rel_score0.207
Overlaps_transcriptC18E3.6 Source_evidenceePCR1029WS150 Sequence/Annotation Release
WB_DNA_textsjj_C18E3.62233caaaatgtcattctttttctggcagaaaattccgatttttaaaagttatttttacaacattacagatggatccttctgttgtgtctcgattggagaatgttgcgaatcgaacggagaatatattgctgaaatatgactcgaacaaaaaaggcaattaaataattgttctcgaaattataaattccaaaaaaactgctttttagaaactccggtcgacgcgacgcctcaaatcattaatctttatgacgatgcgatctgtgagaatctcgtctcgttttatgatttatctgcaaaaattggaggagatttgaatcgccttggatgcatggtaaggaaatatataatatttaattcaaattttatcgaaaattatgtttcagactaggagtctatttttcacgcatcgatattttttgtggattgcgtgtgggcgcaaaaaggcggacaacgacgagttcgcgactcttgtgaacgatttgtcgaaggaaattgttgcattttccgatttcaaggagaaaaatcgaaaatccgaattctataatcatatctgcggacttgaagctgcggttggaggtgaaaatttgcccctgattccgaatatctatgtgaaaaactcttcattattttatatatttcagcttgaaatcgcttgttcatccattacttttttcaagcacgcgccatattctcattggagcgcgccgtgttgtgtcgatttacgaaattttccaattttttcaatttcagtttaaacgagtttccttaatttttgtgggttttgctttttgttgaaaatatgaaatttcgcgagttttatgataatgttcgattgacccaaaaaaaagttttcgaaaaaaaacaatggaaactcgtttaaaaactgaaaatggcatgaaaattgttgaaaaaatttcgtaaatcgacactactcgacgagcttgaatgagaaaaaaggcaatttttatctcaagggtgtcggttttttcgaaaaatatcttttaatatatatttttttttctttaaaaaatttgattaaacttagatttttttcgataatgtttcggttacaccattgctaaatctgtaaatttgaaaataatacactcccaattatttcaggtttcggttgggttgctgaaccaaaaactcctgctccattcatcaaagatgctatcgatacatcagtcttctacctaaatcgtattcttatggagcacaaaggaaaaaatgatttccattcggaatgggctaaatctatcaaagaactcatgctgagtcttcatgaatatgtgcgacaacatcacacgactggtcttgtctggaattcggatcccggtgcgactccgatgtgtaacaggaaaagtggaggagctccaacgccgccgccaccaccacctccaccaatttcattgattgcgccttccaagccttctggtgtcggtgctctactggaatctctcaatacgggattatcggctactagtcgtttgaagaaagtcacccctgaaatgcaaactcacaaaaatccggtacttcgtgaggtaaatggacagatgaatcgaaaaactgaagaaagaaaggtgagcgagaacaagaaaccggagaaaattcacgaatcgagcattttctgggatggaaagatttggaaagttgatcatcaagttggtaataagaatgccgtcgttgaagttacggataagaaggaatcgatttatatttacaagtgtaacgattctattatcaaggttaatttttattcgattattttttcgcaatttcacacaaaatggccggtttttcaaggcttttatattgaaaatcagtgtcaaaatatataaaacctttttaattttttaaatttaaaaatgtaatttatttcagtttaaaaaataaaaactcggccacttttatgctttttctcagatgttttaagtggaataaattttattttcagatgaaacaagtcatttttgacactaatttttaagttaaacaaattgtggctataaaaacgtaaaattttcggttttccagaaaatcgaaaaatttatcaaattttgttaatgttgatggaaaaaaataaaaagaaaacatatacatttttttctgaaaagaagaaaatgaccgaaatttttagatatttttcgagaaattgaagctttttcgaaatatctgaaaaactagaaattgaaaagaaaccaaaaattccaattacggatttcctgttttccat