Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C23G10.9   

sjj_C23G10.9 RNAi JA:C23G10.9
Simmer:C23G10.9
PCR_productsjj_C23G10.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC23G10.8 Source_evidenceePCR495WS150 Sequence/Annotation Release
Overlaps_Gene C23G10.8 Source_evidenceePCR495WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432C23G10.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII62055486206438
Overlaps_transcriptC23G10.8 Source_evidenceePCR495WS150 Sequence/Annotation Release
WB_DNA_textsjj_C23G10.9891agtgtgctcatttttcatccagtaggatatttgtctcgaatctgccttttctttggccatccactccatgaacgttttatcgttcattcctataccaagttgagggtttttctcatcacagacaatcaagagggcttcattggtcttcataagagtcttttcgaagtctgcatgtttttcaagcatattagattctatttcttacttataaaagctcacctttatcactttctgctcggagttgcagtgcatgaattgaatatgaacgaagactttctgagagatatgctgccaatgaatttattgtatggccgtctggcatattttcttggagaataacaagcgctttttggtgaacatcgcaactgttcgtacataaaagttcttcaactgccgtttcgggtagatttaaagacataagaatttgataatgagtgtagtgagcggcactgggatatctgcaagtttaatcattgttgcaatctataagtcacttcagttctcacctttttccgccagctctaagtgcaaaattgtatccacagtgtaggagatctgattcatttccaattaacacaattttctcttcatccatgtttgatccttaaaaacggaattgagaaagaaatcaataaatagttgattaatcaccaggcaaagcagttcaaacaactagtgcaaacttcaaaagaaaatgagatgttcagaattaaaaaactggtaaaaataaagaaaactgttcaacttcgaagaaattattcaaaaaattcgttcggtgactagggtaaaaaagaggcaattaaaggcgcatgccatttttcggtctcatggtcttgcggtgacgtacgcagccaattggcctggccgttgactgagtattcaacgcttcaa