Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C23H3.5   

sjj_C23H3.5 RNAi JA:C23H3.5
Simmer:C23H3.5:Repeat_a
Simmer:C23H3.5:Screen
PCR_productsjj_C23H3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C23H3.5 Source_evidenceePCR751WS150 Sequence/Annotation Release
Chunk_score Abs_score730
Max_abs_score730C23H3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII4779148977
Overlaps_transcript C23H3.5.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
C23H3.5.1 Source_evidenceePCR751WS150 Sequence/Annotation Release
WB_DNA_textsjj_C23H3.51187cttattgtttggcacgggttccgaagaaaaattaaaaattatttgattttgcctattttttcgttttttctcggtgtttttcaagagagaatatcaaatttaaaaaaaaactatattttcaattaggtatttaattttcgacctttaaccgtaatttcctctaattaccaggatatttcaaacatcttgatttcagaaatgctggatgaattttcaaatgatgtacctggtagtttttttgaacgtgagcccacaaaggatacaacgaccgctcgaacaatgcactttttgttgaaaagcattgttggccaactcaaaaatccgataaacaccgaagcagaagctattgctcagtggctcatctacaaacaaactggtccgcatcgtcatcagaagttttttggacattttcgtcaaatgagcagactcgtcaagaaatacaatgaaatgtcattaatcaaaagattgaatccacagttgagaaaagctgaaaattgtggtggtgacgacgtgtataagctggaaataaaagctgttcgatatatgggatgtgcctatgtcaaacgagtctatctgcttgaacgaattcgtgaatcgtgtgtaaagtgtgctgacggagctattggattactagaaattgaccattggatcaatttatcgcttgttattgtggctctttgctcacaaattcattcagaagttgtcgctcaagtgcttgaaatggaaaaagtgtataaaatagcagccggtgtgatgatgacagccgatttgaaatttccgaaagaacttaatgatctagaagttgtacggaagattaggcacgagtcaagaatcttcgatgaaaggagaatggaaacttcaaatctaacagcaatcagccgtcttttgaagtataatgctgaaacaatgaagcaagctcaaacggagaatgatttgagaatgaaaacgtaggttggcaaaaattgattttttcaacaaaaaaattaaaacacaaaatggccggaaattattaaaaattagaaaaaaaaattgatcagaaaaataattctatctataaatatatgaaaataggttgatttcaatgagaaaatgattttttctgaataaattcaaattctgctaaaattttataaagaaagttgaattccctccaaaatttttctgaaaaagtttgaattcccgcacac