Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C24G7.3   

sjj_C24G7.3RNAiJA:C24G7.3
PCR_productsjj_C24G7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24G7.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
Overlaps_Gene C24G7.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474C24G7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI40984184099550
Overlaps_transcriptC24G7.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
WB_DNA_textsjj_C24G7.31133tatcaattttggtgtttatgggctcctagtgtttgataagcagaaaaaagtctttgcagaaattaacccagtattgcatcggatccatttcaaattacccatgagcttgcaagcacgtttggggtctctcataactttataccagataacatgaaattgctcggcatgaggaaaattcttcgtcgattcctacctcattaattgacccgttccaacctttttcaccaagtcaatgttttataaactcttctcactctccagccggcgacggttggttgggccggcttattattgaaaacgagaagtgggtgttgtacgctaatcaccatatacaagctcagtggattggagaaggacaaaccgcacaggatgttccgaaactcggcctgcgctcgaaaaacgtatgctctctgtttggtcgggagtgcatggcccctctactgggagctgttacctgagggtgaaaccataaccgtagagacaaactctagataactacggaatttgagggaaacattcgatcgttcagtcttacaggataagaaagtatatttccaacataataacgctcaaccatatgttacaaaacatgtgaaggaggatctggcaaaatgtggatggccgattctcactcaaccaccgtattctcctgacatttctccaagtgattgttggcttctctccaatctgacttgtgccctccgaggtagatccttcccaacacgagaaaatctccaaactgatatcgagctatactttgaatccctgtcagctggattctacaggcagggaatccacaagttaaatgaatgttggcaggacattgttgaacatgatggaacatataactgatttcttgtttgagtttgcttcgagaaataaatgattgaaaaataggacaggactttcccgacagcctgatagttgtaaagagagagagagagagtgaccacaatattaccgcaatgtgtcttgggcatacactgtcggttctttattttttctaattaaataataactccataaaagaaaattggttgtaggcagacatgatgccagtgcagacgcctgaagacttttttgcctacctgcattacagaactattctaaaaaacttcctgcaattgaaaaca