Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C24H11.2   

sjj_C24H11.2 RNAi (10)
PCR_productsjj_C24H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24H11.2 Source_evidenceePCR709WS150 Sequence/Annotation Release
Overlaps_Gene C24H11.2 Source_evidenceePCR709WS150 Sequence/Annotation Release
Chunk_score Abs_score625
Max_abs_score625C24H11.2
Specificity_index0.5
Rel_score1
Map_statusUnique_ePCRIII1179012711791300
C24H11.1 Chunk_score Abs_score625
Max_abs_score625C24H11.1
Specificity_index0.5
Overlaps_transcriptC24H11.2 Source_evidenceePCR709WS150 Sequence/Annotation Release
WB_DNA_textsjj_C24H11.21174ggcatgagcctttaaccgtaccgcaagcactattccagagcattcttccaaatttggaagatataggttttctggtacatacgtatgcctctccttttcacaatattttccgaattgccacgtggcgtgaagaacgggggacacacgatatagtggaaaattggaggtcatcttggtattacaggaatgacgtcacgtaaaaaattgttaaccatttttaaaaaagtgtgatctattcccaagttcccccaaaaacactttattcaaattcagacagccaaaaactcaatgaggaacatttgaagtcgtctgatccttggcattctcctcgcactcatcacgtcgaacttcgaaatcttcgggtttgagctgaacaaagctaagttcgagcatcttgttgaccaccacaacagctgcataattgcagagctcaatttgataacgagatgccgagaagacagtgatgaggcgacgatcagcgaagaatgcatacccgtactcgaccacctggagaatatttatagttaatagagcacaaatagaactagtaaaaagaccaacctgatgagctctgacaatcaaatcgatatccaatctcttgcacaaatcatcaacctccttctttccaaagacgttcgagattgcacggatcttgttgggctcaaagcctttggcatccttttcagggtctgcccacagcaagtcacaagcgagaggctgaaatggtattaagatgaaaagaagcgcagactatcgatattccgatcaagtcgggcattttgacggaaactcacatgagtctttgcagtttccagtggcaatgggattgcacgaatatcatcgagagacttcaaatgtggagaaatccctccgtgcatgcagagaatacgcttcgagacgattgcacacaggggcatatacgagaagacttgattgaagtgattgtaaaccgattcatacacttcttccctttggaaacgcttcttgagctccgcgtggaagccgtagtttctgttaccaataagattattttgtgtcagatctactaacatgtgcttacttgttgatggccttcaactcatgatttcctctcaacaaatgcatctttctgggcattgccaatttgagtgagaagagaagcataatgacttccaatgagtgacctccacgatcc