Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.10   

sjj_C25A1.10RNAiJA:C25A1.10
PCR_productsjj_C25A1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C25A1.10a Source_evidenceePCR2241WS150 Sequence/Annotation Release
C25A1.10b Source_evidenceePCR1416WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.10 Source_evidenceePCR2241WS150 Sequence/Annotation Release
Chunk_score Abs_score2199
Max_abs_score2199C25A1.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1018799710190286
Overlaps_transcript C25A1.10a Source_evidenceePCR2241WS150 Sequence/Annotation Release
C25A1.10b Source_evidenceePCR1416WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.102290gaaacgctatcctttgtcatttgcacgcgtcggaatggtgaagactttctttttcggttttcatagaccgccttttcagtcgaggtagccaatggttttgccttcaaagccggtgttcttgaactgctctcctcggtctcggcggattcttcagagtcagcacgttgtggtcttggagtgacagccttagatggttttggaagatcttcgtcgtcatcagaggaatcagaagattcagctttctttagtgcagtctttggagttgattttgctggtgtggtggcagacttctttttcgttttctcatcatccgaagaatcgtctgacgatgaagaggcttcttttttcacagcggtttttgcaggtgttgacttggctggtgtcttcttagccggtgcctcgtcatcagaagaatcatcggatgaatcagcttttttggcagattgcttaggagtagcttttggtgttggcttggcagtcggcttcttttcatcgtcagaagaatcatctgaacttgaagccgctttctcttttttcgggacaacgttaggagtttgtttcaccactggtttcttttcatcatcggatgagtccgaagacgatgctgctgctttctttgtaactgacttcggggtgactttgacaggagttgcctttgtaggcttcttctcatcatcggatgaatcagaagacgaatcaactttcttcgctacaatcttgactggagttggcttaactggagtctttttcgctggagcctcatcatcagaagaatcagaagatgaatcggccttcttggcagcaggctttggagttgctttagctgatgttggcttggcaactggtttcttctcgtcgtcggaggaatcagaagatgaggaggcggctttcttggcagtaggctttggagtggtcttagccggtgttgacttggcagctggcttctcgtcatcggatgaatccgaagaggattcggccttcttggaagcaggctttggagcagctttagctggagtctttttcgctggagcttcatcatcagaaaaatcagaagataaatcggccttcttggcagcaggctttggagttgctttagctgatgttggcttggcaactggtttcttctcgtcatcgcttgaatccgaagaggactcggccttcttggcaacaggctttggagtagcgttggctggagttggcttggcagctggttttttctcgtcgtcggaggaatcagaagatgaggaggcgaccttcttggcagtaggctttggagtgatcttagccggtgttgacttggcagctggcttctcgtcatcggatgaatccgaagaggattcggccttcttggaagcaggctttggagcagctttagctggagtctttttcgctggagcttcatcatcagaagaatcagaagatgaatcggccttcttggcagcaggctttggagttgctttagctgatgttggcttggcaactggtttcttctcgtcatcggatgaatccgaagaggattcggccttctttgcaacaggctttggagtagctttagccggcgttggcttggcagctggcttcttctcgtcatcgcttgaatccgaagaggactcggccttcttggcaacaggctttggagtagctttagctggtgctggcttggcaactggtttcttctcgtcatcggatgaatccgaagaggattcggccttctttgcaacaggctttggagtagctttagccggcgttggcttggcagctggcttcttctcgtcatcgcttgaatccgaagaggactcggccttcttggcaacaggctttggagcagctttagctggagtctttttcgctggagcttcatcatcagaagaatcagaagatgaatcggccttcttggcagcaggctttggagttgctttagctggtgctggcttggcaactggcttcttctcgtcatcgcttgaatccgaagaggactcggccttcttgacaacaggctttggagtaggtttagctggagttggtttggcagctggcttcttttcgtcgtcagaggaatcggaagatgaagaagcggctttcttggcaacaactttctggagaacattcgcaactggagtaacctgtaaaaataattgatattttaaaatattcgtatgatgaatttcgtacctttactggatttgctttcttgcttttgccatcgtcgctatcctcgctatcactgtcggaatcactggtatcctgcttctttgccattggctttggagcaactttggttgtaacagct