Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.11   

sjj_C25A1.11 RNAi JA:C25A1.11
Simmer:C25A1.11:Screen_A
Simmer:C25A1.11:Screen_B
PCR_productsjj_C25A1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.11 Source_evidenceePCR718WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.11 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score Abs_score634
Max_abs_score634C25A1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1019501310196108
Overlaps_transcriptC25A1.11 Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.111096agattccaccaatatcttccgataagttgatcactgctcaaaccaattaaatcactaaccctcgcatcaataaatgtcatttttccatcttccgaaacacgaaccgaaaattgatttgttgatgttggatcagcacagaccggcattgatgctacctttaattaaatcacgtttatctgcatcgtaaactattctaacctgtaacctggcaattgccaccaaacaagatgaagctggagcattaattccctgtggtggagcatttttgatatatcctgtgcaatgcatcacaacgtaattttgaccagcatgttggaataagggacggcgatttctgagacgatgaagtggttcaagggctccgacacgcattcgacagatgaatccacgacgacatgacatatgaactcgtgttgatgctccttcgcgtttcactgatcctaaaattcaatgattttgatagttaacttgaagtgggttactgtacttttaaagatacacacattttaagagcgagcagatacctttttgacggaaaatcacaaattttgggcatgccaaaatctagtgaaattacaatagatgcttttaaaacaaatactacttaattcgattgactgaagtaagtggttattactgtaaacggttccaagttatatgactactttggaaaaaattcaaaaaatccttgaatctctcctcttctctttttatgataactcaccagatttcaaatcgagaactttattaactgatacttcacttccacacaattgatctctaattttatcttgatcatctggatgtatgagttcattcaaatttctttgaagccaatcttcctaaaaattaatatttatatttcaataatgaaagattcaaatcttgctcacctgcttcaaattaagtacgggagtaattgaatcagcaacatataacacttttccagtctgacaacaaacaacaaaaagaaatccattcgctgcttctagaatcaaatgtttcaattcttgatccgtaagaaatgatggtttatatgaagtttcatcttgtgccgtatgtcctcgaattcctttcatgtgtgatactgccattc