Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.15   

sjj_C25A1.15RNAiJA:C25A1.15
PCR_productsjj_C25A1.15
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.15 Source_evidenceePCR276WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.15 Source_evidenceePCR276WS150 Sequence/Annotation Release
Chunk_score Abs_score255
Max_abs_score255C25A1.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1019710110197943
Overlaps_transcriptC25A1.15 Source_evidenceePCR276WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.15843gtgcaatggatcgagagtaaatcaattaattatgtaaatcgtcgcttccttgcccgatgagagagaaagtatggaaaatctagagtaagatgcgtcagagaatactctccattgtagacacaatgtctttaaacacgcgatacgtatgtctgagtctccatttttcatatactctcaccaatcaatatttctttaggatgatgggggatgggaaaggaatggtgtgagagagaggggcgtgcgcgctttttctatttgtccagtacctcgtcaccaaacaccgttgaggaccgtattattactatgaagagagaaagaaatgaaaagaaattgagagtgacccccctacatatggtcactggatatttgagagaagaagcaacagatggaattagaggggagagactttttaaggatgatgaaggaggaaacggaaaaaaattagaagatgatggatggatgatagggcatataaaaatgtgatagtgataatgcaagaaaataagtgaaataatgcacgcatttatagtgtgaccagtatttgaaagttgaatgaccacaattgattgatcaaatttttttaactttcacactctcaattaaaatcattttttatttgaaagaaaaccttttgcataggcccctataaaacattctgctacatgcctcgcactttgaactaaaaaatatcgacctgaaaactgttccttggatgtttccaactttcgagttttgtgaaattgttccaaaagtgtagttttttatcaagttaaagttttctttctaaaaaaacacacataattcaagctttcagaatgtttgtttcagatcgacttttccact