Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.3   

sjj_C25A1.3RNAiJA:C25A1.3
PCR_productsjj_C25A1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C25A1.3 Source_evidenceePCR1143WS150 Sequence/Annotation Release
F16C3.4 Source_evidenceePCR201WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.3 Source_evidenceePCR1244WS150 Sequence/Annotation Release
Chunk_score Abs_score1139
Max_abs_score1139C25A1.3
Specificity_index0.892
Rel_score1
Map_statusBest_ePCRI1015965210161886
F16C3.4 Source_evidenceePCR201WS150 Sequence/Annotation Release
Chunk_score Abs_score138
Specificity_index0.108
Rel_score0.121
Map_statusBottom50_percentile_ePCRI1015965210161886
Overlaps_transcript F16C3.4 Source_evidenceePCR201WS150 Sequence/Annotation Release
C25A1.3 Source_evidenceePCR1244WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.32235ttcgttattccctgtttttgagattataatttaaatttcatgttgtagctttgccttacgaagcaatgcaattcggagactaagaaaatgcgtgttgttcgtgaaagatctccgccgaagacctcaagcactgatgaatcggataaggaatcgtttgacacttcgaacagagttgccaaggtaggaaagagagaatagttgcatatttaaaagttaacattttcagaagaagaaggagtaccttcctccgctcgatactactcaaacagaagaggatgacgatatcaaatcttgaacttttgaactagaatttgaatatgacaatgtatttttttaatgaacttttgagatgaacaataaatagcaaaatgaatgatagaacataatgataaaataatattaaaattgaaatattgagatcaactgaaatattcctaatttgtctgagcttcttgatgctcacaatcttcctgatcttctttctcttcgctttcagtaacttctttctgctctgattctgattcagcaactggcttcgtggtagctggttcttcttctgttttctcagcttcagacttcttctttcggaaaccaaacaccaaatacatacagatagcttcccattcagattttgaaagtgttcccatcgtcttgattctctcatcttctggaaatgcgtcgagtttagcttttgcctccaggtactcgtcgtcggattttccactgagcttctcatttggatacgtttcaagacctgtcattgattcgagaagtcggcgtcctggttccaaccatttgttgattgcttcagcgaaattatgcacgaaaagaagctccatgtcaagctcttcgagcaggctgaaattttgaattatatgaattcattaatatagcttctgatcagaggattttgagatatgcggcctgtgacgttctgtacttttaaaaaattttctctgatctcatcgttgtgtcgaagctttttttggaaattcatatagaaaaatagccgatcggcattttcacccgccatatttcgacgttcgtggtagcttttgagcaaatgttttattttttaattaaaagtaaagttaccgtcagaaagtacagatatttctctatttttttatataaaattccaaaaaacattccgacaatgtgccaaaattattataagtgaagaaaacttactgtttgacaagtggaaaatatgccagaaactcaggacagttgacttgctcatcgagtgaaaaatggaacttggctccgaatagtggaacttttccttcagccaactcttccacgttttcatatgtgattttacacacctcgtttgcaaattgaccattttctccgttacgcatcgaccaactgaaaaatagtggataaataaacgtttctattcgaaataattacgatggtttttaagaaaaatttgtataaattttgcttacacaattctatcagcatctggaagtgttccgataaaaactcctccgggtttcaacattcctacggcgttttttagaaatattctggcagaagcttcatctacaaacgagtaatgcaaggcgaactgacagctgaccaaatcaaatggatctttgttttcaatacgatcctccagattctcctgaaatttttgcgctttttattgctatttctcagtttttactgctaaattcaggatgaaaactcacttttgtgcaatcagcgacaatgaattgaacagtgaaaatgttgttctttttatatccgaacatttgtttatatcgttcttctgcttgttggatagaaacatcggcgacatctgaaccgtagcattatatatttttaaaagattccagctgttcatacctgccattacaacatcttttgctccagctatgtcccattttttgagatctcctccttttccacatgctaaatctaagactcttggattattaacgccgttatcgttaacacgctgtttcgcatcatctggaaaaaacaacagtttttttctctaactcaattttcgcaaaataacttttttatttcaaacagtagaatatttacaattattttataaatttaatatcttactgataagttggctcttcacccagttattcatatttctcataaagaaaatacgactttctttcctgccttcgatgccaacctgtagaactttgttgtagtgactggccacttctgatgagctcattttgttgctgaaaaattggattt