Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.4   

sjj_C25A1.4RNAiJA:C25A1.4
PCR_productsjj_C25A1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C25A1.4 Source_evidenceePCR1018WS150 Sequence/Annotation Release
Chunk_score Abs_score934
Max_abs_score934C25A1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1016943010171123
Overlaps_transcript C25A1.4.2 Source_evidenceePCR783WS150 Sequence/Annotation Release
C25A1.4.1 Source_evidenceePCR1018WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.41694ttttgctcatgaaggagagagacgtcttcaaaacgcaattaagggcatacggtaaaacgtttgagcagcagttgtcgcgcgcaaatcagattgcgtgaagctcttgtttgatgcgggacacacatgctaaattgtcttctgaatagcacctcaaattgtgcggcgctcatctgaagacacacttgtcacgtcatttattattaaaacttttatttgtcaccatcctgccagaggaaaatatgagaaatagttttagagtgatgaaaatgaggaagatgttttaaattattgagattccgttgacaaggaagcctttttaaagggataaggaaggatagagatggagaaaaaacggataaaataaagataatagatgatgattcaagagaaacgtgagaagtttcaaatacaaatataacagggggaatgaattaggcgtagtcaacgctgatcatgcggccttcgacagtggatccatagagggcagcacgagcacgttcagcgtcttggaaagttgcaaaacgaatgcgagcagctcctggcgccatcatatcaacagagtcgacttctccgaagtttcgaacacggtcacggacaatttgccaggtataatcgcttggaagctgaataacagatcataaatgagaacaaattgaaatttgaattgaaaacttacgttgcgaatgataataacccttgttgcctggggtgtcgcagcaccggcgagtccaccagctccattgacaccaaagacgtcaggttgagcaaatgtggctccaccagcaccaccaacaccagcatttcctccaaatggtccattgttcatgacggatcgggcaaagttggcttgttcaacgactcctccaaaaccaccagccgaaacaacttgtggtccacctacgaatggggcagctggagctgtgaactgaaatatagataattaaattaacttttaaaaattttataattgagtatttgttatcaagagtttcatcgaacattttttgtgcttttttcagagaaagttccgtttgttctgaaaatcgaaaaacatgtttagcaaattggaatataaaaacccatttttgtattaagttttcagattgttgatggggaaaaacataagaaaacatatcgttttcttataaaaggccatttttcgaaaaatcaaaatgttggaaacccgaaaatttctgtttaaaaaaaattaatttttcgatttaaaaaaatctaaaaccaccattgaatgctagtatataccacaccgatgaaatttgttttaaatcgcttaccggcactgaagcatctcctgggaacattccatgaacattggaaagtggtgctccttctgctccaagacccattccgattgactcaagacctcgtggaagtccaccttctttgtgctccagttccttatcgaatctatccattttcacaaccagatttcgatcaaaaagtcgctgaccattgagcatcgaaacggcttgtacggcttcaattgggtgagtgtattgaattacgcatactccctggaagacaccatttatattttataggaactataaatattaacaaacctttgactttccttctttatcaatgcggaagtccatccaggtgattttaccggccataccgaagacttcgtaaagcttatcggttccgacattgaaagccaactgaaaatgttt