Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.7   

sjj_C25A1.7 RNAi JA:C25A1.7
Simmer:C25A1.7:Screen_A
Simmer:C25A1.7:Screen_B
PCR_productsjj_C25A1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C25A1.7 Source_evidenceePCR1055WS150 Sequence/Annotation Release
Chunk_score Abs_score992
Max_abs_score992C25A1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1018247610183627
Overlaps_transcript (3)
WB_DNA_textsjj_C25A1.71152ggtagcaaaattgacacgagaacgtgaaaatactgatgtatggtgggagattgatgtaaaagaaatattggaaaatgaagaagttcgaagatcgttagaaattcccagtgatatagtttctcaattaaagaagaatacggatatcatggatgtatggctggattctggacttgcttggcatgctgctagagataatgacactgaacgagaacacgtggctgatgtagtcttagaaggtgttgatcaattcagaggatggttccaatcacttcttctaacatctgtagccgtacaaaataaacttccatacaaaaagattattgttcatggattttgtattgatgagaacaataataaaatgtcaaaatctatcggtaatgttgttgatccaacaatgctcacggatggatcattgaagcaaaaagcaattggagcagatggtctccggttttgggtggctttatccggttcagagaacgctggagaatcaaaaatcggaatgaaaattatcgacgatgtggacaaaaaagttattgcttttcgaaatggatttcgtttcatgattggaggctgtcaaggatttgatggaaaacaagtcaagtttccattaaagacgttggatatagatatgttacaaaattgtgacgcgattgtcaaaagatccattgttaactacaacgacttcaaattccgtacagtggcaaatgatttgacacagtttttgcaaagaaattttagtgcaaactatgtggtatgattcaaagaaattgagtactgaatcttgatattttaaatttcagaaatatgttcgtgatcgtctctactgtgataaagttggcagcgagtctcatatatctgctcaattcactctccataggtatttcaagtaagatttttagaactctttttattcattatttttcaggcttgctcacaatctagctcatatcatatctccaatccttccgcatttatcatcagaagtcctccagcaccttcccggatcccatgaaaaacaaattcttcgcttgaaatttgaagatcttcattatggacttctcactccacatgatcagctttcaaagcacatgaaattcgtatacgaagttcgaaatcttttagagtcaactgctggtccaaagattgatactt