Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.9   

sjj_C25A1.9 RNAi (5)
PCR_productsjj_C25A1.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.9 Source_evidenceePCR823WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.10 Source_evidenceePCR8WS150 Sequence/Annotation Release
C25A1.9 Source_evidenceePCR840WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714C25A1.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1018640010187509
Overlaps_transcript C25A1.10a Source_evidenceePCR8WS150 Sequence/Annotation Release
C25A1.9 Source_evidenceePCR840WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.91110acgaacagtcattcacgctgaggagtcctacatcaaacttcttccattttcagaaaatagcacagagatttccagttatgtaagtatcttatttctactctaaaagctattatcctgacactattttcagagtctccaagactttgtggccacacattttattccaattatgattgaagaaccggaaaatcctgtctattatacagcttacgcagttggaacaatatttttcctattgggtgctcgacggcgagactgtgtatatttgaaggatttacttgcttcaacacttctactacaactcgaagagtgtattcatgcagagaatcattgcttatcacctccgaaaattgatgtgtatgatttatcagtgccataaattgcttcaaaaagtcttttttcagattcaccgtcgctcaatttcgaaccactttatcagaattccgattccttgactcccaacgaaagggattgttggcgccagcggacttgaaatttttcagagagtatgaagaaattatttttcagtctataaatcctatttttcagcggaatcttcaatgaggttttcaccaagcgaatcttcgaaatttcaataacctatgaagatggacgtattgatttcaaagcgttcgttgattttgtcaccgctctaaagttccgtcatgtaagcgattttttaatcagaaccaaaaaattgttctaaaaaataaatttccagaccactgcctccgccaaataccatttcgaaattctggatctaaaggatgatggactgttggatgaggaagaaattcgatcaatagtgagtaaaactctccaagaacactttctcatcgcttaaaagtcatcatttcagcttcaaaacctgccagattacgtcccggaagataatagtgtgaacccggaagtagcaactgccgaactgagagatatgatgcgtctgaatcagaatggaattacattggaagagtttcttgctaatcggatgaactcgacgtttgctggattcctctccaattccgatgattacatgaagtacgaacgacgcgagcaatagcagtcccgctaattttatttttaaaactattctaaccactcatttcggcc