Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25D7.2   

sjj_C25D7.2RNAiJA:C25D7.2
PCR_productsjj_C25D7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25D7.2 Source_evidenceePCR837WS150 Sequence/Annotation Release
Overlaps_Gene C25D7.2 Source_evidenceePCR837WS150 Sequence/Annotation Release
Chunk_score Abs_score732
Specificity_index0.315
Rel_score0.79
Map_statusTop85_percentile_ePCRV1504039715041413
C25D7.14 Chunk_score Abs_score927
Max_abs_score927C25D7.14
Specificity_index0.399
Rel_score1
C25D7.12 Chunk_score Abs_score662
Specificity_index0.285
Rel_score0.714
Overlaps_transcriptC25D7.2 Source_evidenceePCR837WS150 Sequence/Annotation Release
Overlaps_pseudogene C25D7.14 Source_evidenceePCR970WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1503697815037994
WB_DNA_text sjj_C25D7.2_11017atggaatgacggtaagctcgcgtggttggtcactctcgaagactcctttggcacaattttgttctgatgaagcattggatgttaagacaatcatgtgatcagtcttctcaacaccattgtgacggagcacatcgatcgaaagcttgtctcccggctcaacgaatccaaagactgggttgacacggtacagaagattgtcagaggttttgacctgaaagctattgtttttaatgagcctgaagccaaagcccaagccaaaggccaaagcttaccttaaacgcctttctcgacttggtgttgttcgcgatgctaactgtctgaacaccacccgttgttgcgaatggcagcttgttgggtgaagcacgaagggtggatgtcttcactgaggcagtcccctgtccctccgggaatgtgtagttcgactgattgggaaccaatttgagagccttcgatttctcggacttctccccagaatttgatttgatggacgcatcggaaacaactgagaccggtgggcagaggttctgaaattttttgaattgtttttatattcaaaactgtggaaaaaatcaccttcgccttgttcaggtcacacttcttggccgacttgtcgcacttcttagactttgaagatcttctggatctttctgatttcgacgacttgtccttgtcacgtctcagcttcttcgattccgacttaggagctccccgtgctccggggactgcaagaggtctaacgctctttgatttcgacttcttggattttgaaggctttccacggcttaagtgtccagatttggacgactttccagatctcgtcgacttcgcggatttttgactttttgaagcacgagacgacttggttgcggatgcctttttagattgattttttacggtcctgaaaatgaatccttgaattaccggaacaaactgaaacacttaccgcttgtcgatccttgctggagcccatggcgagtacggtactagtagccgaggctgtggcaatcaaagaaacca
sjj_C25D7.2_21017tggtttctttgattgccacagcctcggctactagtaccgtactcgccatgggctccagcaaggatcgacaagcggtaagtgtttcagtttgttccggtaattcaaggattcattttcaggaccgtaaaaaatcaatctaaaaaggcatccgcaaccaagtcgtctcgtgcttcaaaaagtcaaaaatccgcgaagtcgacgagatctggaaagtcgtccaaatctggacacttaagccgtggaaagccttcaaaatccaagaagtcgaaatcaaagagcgttagacctcttgcagtccccggagcacggggagctcctaagtcggaatcgaagaagctgagacgtgacaaggacaagtcgtcgaaatcagaaagatccagaagatcttcaaagtctaagaagtgcgacaagtcggccaagaagtgtgacctgaacaaggcgaaggtgattttttccacagttttgaatataaaaacaattcaaaaaatttcagaacctctgcccaccggtctcagatgtttccgatgcgtccatcaaatcaaattctggggagaagtccgagaaatcgaaggctctcaaattggttcccaatcagtcgaactacacattcccggagggacaggggactgcctcagtgaagacatccacccttcgtgcttcacccaacaagctgccattcgcaacaacgggtggtgttcagacagttagcatcgcgaacaacaccaagtcgagaaaggcgtttaaggtaagctttggcctttggcttgggctttggcttcaggctcattaaaaacaatagctttcaggtcaaaacctctgacaatcttctgtaccgtgtcaacccagtctttggattcgttgagccgggagacaagctttcgatcgatgtgctccgtcacaatggtgttgagaagactgatcacatgattgtcttaacatccaatgcttcatcagaacaaaattgtgccaaaggagtcttcgagagtgaccaaccacgcgagcttaccgtcattccat