Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25F9.4   

sjj_C25F9.4RNAiJA:C25F9.4
PCR_productsjj_C25F9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25F9.4 Source_evidenceePCR919WS150 Sequence/Annotation Release
Overlaps_Gene C25F9.4 Source_evidenceePCR919WS150 Sequence/Annotation Release
Chunk_score Abs_score856
Max_abs_score856C25F9.4
Specificity_index0.55
Rel_score1
Map_statusUnique_ePCRV1941422419415199
M04C3.2 Chunk_score Abs_score572
Specificity_index0.367
Rel_score0.668
Y43F8B.14 Chunk_score Abs_score129
Specificity_index0.083
Rel_score0.151
Overlaps_transcriptC25F9.4 Source_evidenceePCR919WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25F9.4976cagctctcatttggttgtagctttcctcaatagatgtttgcgtagctttctcaattattttgattgctttctcaaaattttcgataatatttttcattgctgttttcccaatgaaacaacgatcttgctcgcttttggaaaagttaaagtgcgcgtccacccatattttcataataagaccgacatccgacgtgtttttaaaaccagcacaaaatgaatcatacatttcttctatatcctcatcactttctgcacaaattttgaaatgtttgatgtagaactctttggtgtagctgactattgcggctaacatattgttgcaaaatttgctgatattgggctcattttcgtttttttctttttttgcattagttatgtgttttttataatcattcgctgcaaattttaaaatgctaattttagtaaattgaatcgagattttatacaacttacgacttcttgggaaacgcaaggtaacttgcttcaaaaagccttcaatgtttttaaccagttttgcagtgcttttttcttcatcgtctttagcatttcccaaagaaattgattttatcaaattatgactttcaccatattctttccgattcataaaacgagccaatttttgttgcgtcggattttccgtcaggcaccaacgatattccgcatgtaactggcaaagaaatgaaaaaagtaattgatattgttgcctgtctttttcgctcgctgaataattatcctcgaaaataattcgtttccatagaatgttccgattttcaatatttttgagcatgtcgtaagtagtgataacgacttcatgactatcatctggctttttgtcttcatttctatagaagtagtgaatcacgagatcatctttttccaaaagtttttcgagaagtttcttccaagattctatcatatcgggtggcacaaccagtaaagttttccccatcgaatgaccatattcttcgctcgtatt