Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25G4.4   

sjj_C25G4.4RNAiJA:C25G4.4
PCR_productsjj_C25G4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25G4.4 Source_evidenceePCR763WS150 Sequence/Annotation Release
Overlaps_Gene C25G4.4 Source_evidenceePCR763WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV1245234612453511
Overlaps_transcriptC25G4.4 Source_evidenceePCR763WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25G4.41166tgtaaattctcgagcagtgtgaagactctcttgacttgaagatgatgttctcggctgatatttgacactgtgctcctcggccaaagttgattgaatatcgttaaacatttcgtcatgtttccgctgttggtaagcgtttcgttcaatcgattgaacacgatgaacaacgacaggtggaattccgagagcgaatgcagtacgagtgagcatgttggcagtggtgggagtgacaggattatccataacggattgtttcagattgattgcactgacaatgatgtcgtcgcagaaatgaccgataacaccggtttgttgcatttgagaccagaaattcataggatctgaaataaaaataaattagtgataaatgttatgtcaaatagcttaccgttctgcagacaattgagaatatcattgaatggcgtgcactcattggattccttatttgaagaagttggctcttcattagatgacattgattgcagtggtggcgcatcaatgaagaactcctcgaagaaacgatcgtcttgtggctccattttgaccatttgtctgggcttgttgacacttccacgtggacgtccacgagcttttttggcgcctgaaaaatgatatgtttccagaatactggtagttatacaaaaggagctagttttagaatgttctagcaatatagaataatgtttcctttatctgaaaaaacttatatttaagttggaatagttgaaaagatgctcacaaatctcaaactttgagacaatatttgagcacttttccgattgttccaactaaaatataagttatttttagacataacaaatattattcctaaattttaatgaaaaatattgagagaacatgtcaaaactagatccttttgtagaattatcggtcgtactctttctattatcatcattatccgcctcttttccagccatctcattttcgatctcatatttaagttgtccggcttcagatgttctcttggacttccgagcttgaagcacctcttcagatggagcattcacataatttctgctttgacactttccactgcatcgattcatatgctcgtagaagtcgatggtcattgcttccatgtgagttctagaatataaagttttgagaaacagaagtattttaagggattattgtcttgatgctca