Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.2   

sjj_C26C6.2 RNAi JA:C26C6.2
Simmer:C26C6.2:Screen_A
Simmer:C26C6.2:Screen_B
PCR_productsjj_C26C6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26C6.2 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.2 Source_evidenceePCR942WS150 Sequence/Annotation Release
Chunk_score Abs_score816
Max_abs_score816C26C6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75239427526030
Overlaps_transcriptC26C6.2 Source_evidenceePCR942WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.22089tgatgtacatgacatgctgtgaattattcaattttcatcagcgaataaagttatcgagaactaaaatcaaagttttttgtttcaggtagatgcaaaattagtgatggatgtggtggcacgaatggaggacacagagccattctcagaagaattgctcagttcaatgaaacggttgtggggagacgcaggtgtacaggattgtttctcaaggagtaacgagtatcaattgaatgattcagccaaatagtaagtttaattcaaaattttgaaaaattatttcaagtaactattatctccataacaaccaaagtggtttttttcataaattgagaagagtttcctaaatttcgaatcaatatgttacatgtcaagctcattttcaatattaccaaatttaaaatttcaagaaatttcgcagtttatagaatttattaataaccattttttcagtttccttgacgacctggaaaggttaggagaggcaatatatcaaccaactgagcaagatattctccgaactcgtgtcaaaacaactggtattgttgaagttcacttcacattcaaaaatctcaatttcaagtgagttttcttgataaaaaaataatatttaataatgaatatttacagattgttcgatgtgggaggtcaaagatcagaaaggaagaagtggattcattgtttcgaagatgttactgctattattttctgtgttgccatgtcagagtatgatcaagtgttgcacgaagatgagacaacagtgagaaattgatattttaatattttagaagcttttttgttgaaaaagacagacaaaatttaaaattagaaaatatcgtttagagactttatgttttttaaacgattttccaatcatgacttggtcgttcgagtcgacttttacaataataaaaataatgttcttcttctaatttttctaacgaaaatgcaacttctgaccgacaatatatttgccaaaataaaagaaacatgataatttaaaaattactcgtttttttaaattatattctattattcattctattattcattattcattattattcattattgttccttatttcatattttcagaaccgaatgcacgaatcgctgaagctgttcgattcgatctgtaataacaaatggttcacagatacatcgattattctgttcctgaacaagaaggatctgtttgaagagaaaatcaagaaaagcccgttaacgatctgcttcccagaatattcaggtaaaatttaattgaatttccaataaatgttttaatttcttaatccctgtaggacgacaagactaccacgaggcatctgcgtatattcaagcacaatttgaggctaaaaacaaatcagcgaataaggtaagaaaaaaaagtctaaaaatcaatgaaatcagagaagcctatggggttcctgttccacgaaaagtataaattgtttttctagaataatattttttataatttttaatatctagttaattttggaaattttttgaagtgtgaaacatttataaaatttaattttttttaagtaaacacgaatattcaattgttttgttaatctgtcacagaaaatgataaccagaaaaatctctgaatcgtattcaattaagtaattacaaccaaaatttgagatttttactatctcgacattttctccgatattgcggttactgtagtttcatatttgaataggtagttaaagttgagtgttgaggtaataattttaattcattatttcatttaatttgttttcttttgaaataatattcttatttgcaggaaatctattgccacatgacatgtgccacagacacaactaacattcaatttgtgtttgacgctgtcaccgatgtgattattgccaataatcttcgtggatgcggcttgtattaagctgtcgtcttcgccgccctcttctaccattctgtgtgtatctttgcttacttttcccaaatttttaaagattcgttatttttctcatcccccgagtatgcatctataatttgagagctttacatgtacattatggttgcaactgtttttattttttggaaaaagttgcaatttcagatg