Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.3   

sjj_C26C6.3 RNAi JA:C26C6.3
Simmer:C26C6.3:Repeat_b
Simmer:C26C6.3:Screen_A
Simmer:C26C6.3:Screen_B
PCR_productsjj_C26C6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26C6.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666C26C6.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75296117531309
Overlaps_transcriptC26C6.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.31699cgcccatctttaaaccagaaatatattactggattctcctaaaaaaataaaataatttcaattgtgaattgtttcagatgaatgcaagtctgaaaaaaccaaatgtgaaaatggaggatatatgagaccatcaaaatgctccgaatgtctttgtccagatggtcttggtggagaaaagtgtgagaagaatgaagactcgaaaagtatgttttttgagaatttttgaagtttgacaagaagctgagatctcaatttttcaaatctctatcttattcttactataattagagattatatgaataggcatattttagacgctgaatgtggtggaattattaaattaactgaagaatggaaagagattgaatctccaaattatccggatccaggatatgaagctgatcaaaaatgttcttggttgttgaaagcggaaaaaggaaaacgagtggaaattgaatttattgaagatttctcatttctctgtacatctacatgcgttgattttgtagagctgaagatttctgatgacttgagaaatactggattcaggtttcttttttcttcaaattgatgtttgaaaatgggtgtgttaactaaaatttcagattctgctgctatgataaaccagaaatcagttttgtttctcagactgacactgctattattattttccgatcacaactttctacggatattggatttaaaattcaagcaaaatctagtgagttttccgattaaaaatatttggacagatgaggtttcgtaaatttaaaacaactctgaaaatttttttaattatcaaaaccaaatgtttcgttatattcagagcattgcgacttttgagaaaaatatattatttgaagtatttagatgaattgattattaaaacttttaaaaatagccaaaaaaccaaaatgcaaatactttttcctaaactgtctttaaaaaataattcagccgatgccgaaccaaggacaacaattgctccaacaattatcacaacaacttgtatgtttctttttcatttttcttgttataacattttcaaatttccagtggcaccaataactgttgatgcaccaaatgtatgggcagattggggtgaatggtcaatgtgttcaagaacatgtggaggttgtggaattagaagtcgggtcagatcatgtagaagcaaaaagtgcgagtaagtgatttttaattaacacccttgagagcgttgatcctgattgatttcaaatgaaaatatattcaaaccttgtaaggatatttatctttcaggggacgacgacaagaatttggaacctgtaatttgaaagcgtgccctgttgataaacattgcgcaaagctactatcaaataataggctttgcaatggaaaagtgtgtaccaagtgagttgatatggaatttaaaaactactttaaaatttacatagtgtttaaaaaaactctcaaaaaaaaattaatttaaaaaccttgagcaactctgatttaaaaaaaagtttttgagctttgaagatgctggaattactcaaaaaattacatagtttttggaacttgtgtattcggaacattgtatcgacaatttcgtctgaacattttccaacagattttcgttactttgaattctgttgtttttattttcaaaactgcagaaacgacattgcaatatcgtcatgtgatgctccacaatgttgtcctc