Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.4   

sjj_C26C6.4RNAiJA:C26C6.4
PCR_productsjj_C26C6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26C6.4 Source_evidenceePCR706WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.4 Source_evidenceePCR706WS150 Sequence/Annotation Release
Chunk_score Abs_score601
Max_abs_score601C26C6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75327547534360
Overlaps_transcriptC26C6.4 Source_evidenceePCR706WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.41607gaacctcttgcaggtcaagcaaatctaaaaataaccagcttcattattacttttctcaaatgtggtgaaatcttaaggtcatgattcagcccctatttgcttccaagagctgtgaaaattcgcaaagttttcctaccaccttttagctgaaactaaaacttataaaaactacatcaattttgttattaaccgttatttttgttaattttgaagataaatcttactttgttaaccttagaaaattctttgaaaatcgtgttctatcaccgaaaatcggctgcgtaatgaatgctattgttcaatatctctagctacttaatctaatttttaaatctaatcgtctagagaatacgcattttttgaaggaattgttcgcgacaaaaatcatatttttgcagggaattctcagtccgcatattctgcgtcaacgaaacatagtagtgacagtaaatagagtctcaaaagaggtttgattttattcttcaatttatgaattcaatttttctttttttttcagctttcattcgaagatattcacaatgaatacaattttatgcagttttcggaacaattgaaagcaatgccaaaacctccatatatcatatttgtgggtgcagtttgagaaaagttatcaacttgttcctaaatagccaaacatcatagtaaaactttcccgaaaagtttctaaattttacaaaatttactgtcaaaaagtagcaattactcaatgccatacttttggtcggccaaaaaaacctggttttttttaaatatgagttgtatatcttaataatgttttagtttttgtacaaaacattgtggggctttgaaggaagacaattcttcacaaaatcaaaaagtaaaatttcaacaaaataagtttgcaattcatatagaggaagcaataataaatatttttcagtacgactcaagcaatttggatatattcctcaatcatatttgcaatttagaatttattcctggcgctctttcccgccttgttgccatttcattcgacactccttcacatttaattttaaaagaaaaatatccgaacattccaagcgtcgttatcaatttggattcaattaaggtaacaattattttttaatttgaattctacacattttaacattgctgaatcgattctgttttaaataagttttcgttcaaaatcagtttaaaaatcgaaactttacatttattcgcatagttttcaaaatattttttctaaataatattaatatctgacaaattccagaaaacattaccagagtcttatgaaaatcgccgttacataatctatcaattggttctactgacacgtgctcgtatatgtgcatcattagctcttcgtggaataagtttttgggcaatgcaacaggatacactttgggttgaaaattttgattcaatggatcttgaaaatagatatccagatgaatatatgctttttgacactgttggaaatgagcaggtgagcttcttttagttttaaattatctcaaattaaattcaaaattgttaaaattatcagtttggtgaatacgatcgaatgttcggatggatatgtggatcaacattttttgttcgtggaaatccaacaa