Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26E6.4   

sjj_C26E6.4 RNAi JA:C26E6.4
Simmer:C26E6.4
PCR_productsjj_C26E6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26E6.4 Source_evidenceePCR1075WS150 Sequence/Annotation Release
Overlaps_Gene C26E6.4 Source_evidenceePCR1075WS150 Sequence/Annotation Release
Chunk_score Abs_score1033
Max_abs_score1033C26E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII49395854940702
Overlaps_transcriptC26E6.4 Source_evidenceePCR1075WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26E6.41118gatggttaatgacccgatggacggagactatatcgatgattcggatgaaatcagtgcagaagcatggcaagaagcatgttgggttgttatcagtgcttatttcgatgaaaaggtatttttgattataaaatcatgaaagaatctcttttttgaagggtctcgttcgtcaacaacttgattccttcgatgaattcgtccaaatgaatgtgcagcgaattgttgaggattctccgccagtcgaacttcaatcagaaaatcagcatcttggcacagatatggaaaatcctgcgaaattctcattgaaattcaatcaaatttacctctcgaaaccaactcactgggagaaagacggagcaccaatgccaatgatgcctaacgaagctcgtctccgaaatttgacatacgcctcgccactttacgtagatatcactaaagtggtgacaagagacgattcagcaacggaaaaagtgtacgacaaagtgttcgttggaaaagttccagttatgctacggtctagttactgtatgctttccaatatgacagatcgtgatctaacagaactcaatgagtgcccacttgatcctggaggttattttgttatcaatggttcggagaaagtacttattgctcaagaaaagatggcgactaatacagtttacgtgttctcaatgaaagacggaaaatatgcattcaaaacggaatgtcgctcttgtttggaaaattcatctcgtccgacatccacaatgtgggttaatatgcttgcaagaggaggaggtggtggaaagaagacggcgatgggtcaacgaattattggaattttaccatatattaaacaagaaattccgattatgattgtgttccgagcgctgggattcgtatcagatcgtgatattcttggacacattatctacgatttcaatgatccagaaatgatggaaatggtcaaaccttcgttagatgaagcttttgtcattcaggagcaaaatgttgctctcaactttatcggagctcgtggagcaaaaccaggagtaaccagagaacaaagaatcaaatatgctcgtgagattcttcaaaaagaacttttgcctcatgttggtgtatctgagcattgcgaaacg