Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27A2.2   

sjj_C27A2.2 RNAi JA:C27A2.2
Simmer:C27A2.2
PCR_productsjj_C27A2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27A2.2b Source_evidenceePCR162WS150 Sequence/Annotation Release
Overlaps_Gene C27A2.2 Source_evidenceePCR489WS150 Sequence/Annotation Release
Chunk_score Abs_score384
Max_abs_score384C27A2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII50555475056211
Overlaps_transcript C27A2.2a.1 Source_evidenceePCR444WS150 Sequence/Annotation Release
C27A2.2b Source_evidenceePCR489WS150 Sequence/Annotation Release
C27A2.2a.2 Source_evidenceePCR438WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27A2.2665tttattcctgaagatgccgataatattttgtaagatctcaatttttactttcaggtaatcatggtcccaaagccacacgccaagtcggccaagaaggctcttcgcaagaagaaggtgcacctcaagttcaacgttgagtgcaagaacccagttgaggatggaattctcagaatcgaagatcttgtaagttgtaggctttttaaaattaatcagcctcatcaagtcgatagagttcccgtctctatcgcaagaccaggcttagggtatatattggtccctagtaagtcccggttgttttcaggaagccttcttgaacgagaagatcaaggtcaatggaaagaccggacatttggccgctaacaacgtcaaggtcgaggtcgccaagtccaaggtctcagtcgtctccgaggtcccattctcgaagaggtagcattttattcaatcaaacttgttctcatatttttatattcagatacctcaagtaccttaccaagaagtacctcaagagaaactccctccgtgattggctccgtgtggtcgctgtcaacaagaacacctacgaggtcagatacttccacatcaacgacggagaggacgcaggaagcgaccacgagtaaactcggttttttgttgttggaataaattgttgtttcaaatcaggcttc