Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27A2.3   

sjj_C27A2.3 RNAi JA:C27A2.3
Simmer:C27A2.3
PF:GL1_3F12
PCR_productsjj_C27A2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27A2.3 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene C27A2.3 Source_evidenceePCR832WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769C27A2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII50540595055115
Overlaps_transcriptC27A2.3 Source_evidenceePCR832WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27A2.31057gggaaaagctcctggaaaactttttataagacaaaaacatctgaaacagttataaaatacattgatataccgtttcattgttcagagaatggacatagaaaattaccagtggggggaatgattgtggggcgagggtgatttcgccaatatatgtaaaacaggtagaagaggctgacgtcgtgggaaatcacaggggaaggttggcttcttcggcgaggaggtcgtaactatccaaatcgtccgcaagcatcgaaaagagttcatttctttcagccttactcattttcacttcatcaatatcagcaataacagtccgatggcgagtttcttcgagtttcacatcaccttcttccgcgaaatcctctgttctgagcacataattgaaatcgtcgccaattcttgaagctggatcaattggtggatatgagtcccattcctcgactcccaattcagcaagagcttctgcttcagactctgccggatcgataacgtctccatatggccgatcttcagaaagtacgacgtcttgatcttccaaattaagcatatcgtcctcaatgtcagcagctagcgaatcgaatgtttcacatcggtttgcagtgtcgattggagagcatggatgtttttcggtctagaaaatgatgaaaataaaaattatgaagcaatacttttaattgttttaagattaaaacttccgtagttttcttttcttttaataattatgctggaagaaaacatcacctttttaatggtggccacatcggcaatctgatcatctgtctcatcttcataacattcaaaagcaattggaatagtgttcttcttggttgaaggtggcactttacaagccgatgccaagctctgaagcgattttccgccaggagtttttgacgagtttacaaccagccccaaaccgccacgagaaggtgtcttttcaagttcattttgtctgcctagctttgcacctaaaacaaagacgttataagtaaaataaatatattaaaataaaacttactgaagtgttgttgcaaggaggctggtatctgggtgcttcctc