Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27A2.6   

sjj_C27A2.6 RNAi JA:C27A2.6
Simmer:C27A2.6
PF:GL1_1G7
PCR_productsjj_C27A2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27A2.6 Source_evidenceePCR964WS150 Sequence/Annotation Release
Overlaps_Gene C27A2.6 Source_evidenceePCR964WS150 Sequence/Annotation Release
Chunk_score Abs_score859
Max_abs_score859C27A2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII50799555081139
Overlaps_transcriptC27A2.6 Source_evidenceePCR964WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27A2.61185ttgcttcaaatgaacttgcgaaaccgacgttaaatcagtattgatggatctgctgtcgtcttcatcttcatcataatatgtgacaccgtctcggtaatgatcatccgactctgttgttacatcgaatgtggattcttcataatgattttgacgatggtgattgtggcggttgttgtgcttcatgtggggcaggtgacgttctgcaaaattaagagatttggagatataaaacctttataaagttaccataagcttgcggtgcatgttttctattgtaagcatgcgcctttttaacataagtcggaagagatgatgcttgagattcgtcatcagaaaatggagctgcaaattcaagtgtattgtttgaaaatattttttttaaactaacttggattatcgtaatgatgggcagctctgagatattctctcgatccactgcttcccttcgaggatccgtcttgcttccttctatgtcttcctgagctggtgtcagagtgcacagatccctcgacggtaagcaaatacaactcgaatcgtccatttttcaaaggatatagccgtcgagaatcgtcacgaacttcagctttcacttccctgaaattcagtttatcaataataaacatgataataaaaaacaaaaacccagtaaaaacttacaatccagtatcaggatccagcgcgatgcaataatacttgaaatttgttctcatcagcttccgtttgacatctcgcaaagttatgcaatcaggtggtacgtgcacttccaccatgtaaggatgttcttgatcgtccaagtgacagtaaacctgaaatgttgaatttgaattgttttttgttaaacttaaaattgataaaaatccctgcttaattacctttgtaatggtcctggcaaatgtaagaggtttaggaagtggctccataactgacgaaacagtatcaccaaactctttggaaaaatcatccacataaatgttagaaacatcttcttcatgctctccatgtgcgatatttttcgattcctgtgtttcatgtgtttctgtaaaagcatcaaagctgtccagattttcttgatcttcctcaagaccatttcgatttctcagagaaatttttgcggcaataactgtgcaaggcgtggcaacatctgatgcgtcaaatgatgaatcaattggtgaaggggaatctgtc