Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27C7.2   

sjj_C27C7.2RNAiJA:C27C7.2
PCR_productsjj_C27C7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27C7.2 Source_evidenceePCR201WS150 Sequence/Annotation Release
Overlaps_Gene C27C7.2 Source_evidenceePCR201WS150 Sequence/Annotation Release
Chunk_score Abs_score106
Specificity_index0.159
Rel_score0.228
Map_statusUnique_ePCRI1143285411433574
ZK1025.4 Chunk_score Abs_score464
Max_abs_score464ZK1025.4
Specificity_index0.695
Rel_score1
F41D3.8 Chunk_score Abs_score98
Specificity_index0.147
Rel_score0.211
Overlaps_transcriptC27C7.2 Source_evidenceePCR201WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27C7.2721gaaaacttgcaaactttgtgctttgccctacccgataccatctttagactcagtgtctagaagtacctgccgcagaagatccgaaactagagatagttttgtactggaaaatatgtatgtacttcctttttgggatgacaaatgcgtaatcatctaagcggatctacaacgtctaggacaggacagttttcgggttgtttttgaaacaaactagaaatagaaactaatttatttttgaattcaaaggggctttagttattcaccagttataaataatccctgagtcttatcgtaaacccaactagtgacattatccatttcagctttgcacaggttaccggtactatgacacacatttggtctggaaaaaaagacatttaatgaagttcctggtagttcaaaaaaagttacgttgcttttgctatgcataagttcatggttagaatgggagtgtaggaaaatattggcggggtggctccgaagattttgtgcatctgaaaaactggctaaacatgaaaaaaaaggaagttccagacagtccgaaccgtatcatgcatattccaaatgtgaccttctgtgctgttcgggaaaaatctatatggtttttccacaacgttagctttaatttccttaatattaaatcgaaaatgtagtactgttccattggaaaacagtgtagttgttgagttgtgcaggaattttccgggtgagtgagtagtta