Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27C7.3   

sjj_C27C7.3RNAiJA:C27C7.3
PCR_productsjj_C27C7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27C7.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Overlaps_Gene C27C7.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Chunk_score Abs_score650
Max_abs_score650C27C7.3
Specificity_index0.65
Rel_score1
Map_statusUnique_ePCRI1142962011431889
ZK1025.6 Chunk_score Abs_score350
Specificity_index0.35
Rel_score0.538
Overlaps_transcriptC27C7.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27C7.32270tgttagctttcaaaatgggaaaaaaatccgtttttttctattttttgtgggcctgacacgaaaactcaattaattttttttttgtcaaattgggtcccaccacgaataaaattttcagcggcgtgccaagtctgccagagcactgagcgaacccgtctctactttggcattacctcctgtgcggcgtgtgcagctttcttcagaagatccgatggaattcagtacatgtgtaccgctaataatagctgtactattgcatatggtaggtctttgcctgcctgcctaccttcatgcctacctacctaccaaattttactttcagacatcaagtttttctgccgagcatgcagatatgagagctgtgtccgagccgggatgcggagggatagtgagtttttagtgtgaaatttgaaattttggtttcaaaattttttcagatgtccggaaacatagaacccatcaaaatcaagctgctacaccgggagctgtcatcccaggtgagcttcaactttgaaattcagcaaacttcaaccttttccagaacttcacctacgcctaactcctacagacagcctgggctccagctcctcatccagaagcacatccccagacgattccgaggagttcagtgatattctggatgttagtcaagatgatttgttacagtactacacgaaagaagtcaccgatatgatgtctcagcagagatttgggattcataaaatgagttgtatcttggaatgttatccaagattagctgaaatttcgctgaaaatccaccggacttttattgaaaatccgccaaaactttattgaaaatttgcccaaagtttgccgaaagcttgccagaaatttaccaaaaattcgcagaaagttcggccacaattaaatgaaattcagatgaaaatatgctgaaaattatacaaaaattttctgaaaacatgtcaaaagtttgccaaagatcatcaaaattttggcaaaaattagaaaacattaagttgaaagtttgccgaaaattcgcagattttttgttgaaaatggctgataatatgatgaaagtttggcaaaaacttaccaaaaatattctgaaagtgcaccataattttaccaaaaaatgcctgaatttgccaaaaacagcctaaactaatttaaatcgggctaaattcgctgaaaatttgaaaatttacaaaaaatgttccaaaaaattgcagaaatcatgttgccgagagtcaactgatttgcccgaatttgccaaaaattttgctgaaaatttcctgaaagtttgccgaaatatcgctgaaatgtagcaaaaacttgccaaagtttaccttaattttagcaaaaatatgccgaacatccgataaaattttgtcaaaaattcactgaaaattgggttaaaattagaaaaataacgttgaaaatttgccgaaagtttgccgaagctttgcagaaatttccctaaaaaattccaaaaattcagcaaaatttatcaaaaattcatcaaaattttgcggataattttgctgaaaattcgccgaaatttggactaaaattctccgatttggctaaacaagtgcttcaaaatttttgttaaaaaaaaaattcacttcttactttgaacttgaggccttgtttcattgtgttggataacatccccgcacgtcactttccgaataaccctctccaaaactaggtcaacattctccgaagttgatccaaaaattttcagaacaccctccacgtgagttctatcaccgacctaatgattgtctccgctcatcacgagggatcttccacagaatcctgccttaactgccctggagttgatatgctagacaaggaagatgtggaggttctgctgaagtacttcaagttctccaatacctggattgattcgatatttgctagcttgatatctcccaatcaagtggagcttatccagtgcgatcatgagtaagtaattgctgtgactactgccaaatttaccgtataactttatagggacattgccaaattcatcaatcattccaaatcaaccttaggattcagcctaagccatcttaatctgaacatcatcgagtactcagtcttcaagtccttctgtatctggaagcttgtgtatcatgagacaagcatcgcaatgaagattatggctcaagagcattttgagggtgttaccagtgctctccggaagtattacagggtaaggggaacctattattttctgctgaagtcctgttgtgcctgttttcagaaggaatccaaaatga