Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27C7.7   

sjj_C27C7.7RNAiJA:C27C7.7
PCR_productsjj_C27C7.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27C7.7 Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene C27C7.7 Source_evidenceePCR792WS150 Sequence/Annotation Release
Chunk_score Abs_score689
Max_abs_score689C27C7.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1142222411423396
Overlaps_transcriptC27C7.7 Source_evidenceePCR792WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27C7.71173gcgtcggaaaatgatgagatggtaagttaaatgaatttaaataccagaaaccccctaaatttccaatttattccagatctctccagcaatcaaagacttaaataactataaagtatctatggaaactctcgaaaaacacaatatccctcttctcataacccaaaactgcccttacaacccatttgccatgaatctcaagtcaatgattcttcagtggaaaaatgagcaacttcaagcggagcagccaagacttctcacaaaactcgcggagcatctcggatcaaatcggcattgctctcaacttgtgctccaactcctcataggtcttatgaatctggaaaacatggaacttgttagatcctcctgtcgaattctgagcaagttagaatttaagttagaggaaattgagcgacttgaaattctggaaagagcaatgaaagttcaggagcaagtagaagaagccagtgagttggtgatgaagattttggagcagcttgagcaagaagattccggaatttttgtggaagatgaggaggatgaggggggtgaaaatccaattgtgatggaaatttgcatgctttatctggcagaatgtctgaaaacggaagacaatttaaaggtaagtaatacatattagttgctccagcctggcaggcaggcacatgcctgcctacagcacgtgttgtcagactgtcccattacggtttgatctacagaaaatgcgggaattttttctcccgcatttttcgcagatcaaaccaaaatgggacactttgacacctgtaccaggcaagaaggcattattcaacctagaatggtcaggcaagcttcccaagtgtggtacgcctattctgtgcctactctaactggaaaacttttcagatcaccagcgcaatcaccttgctcggcacccttgctccatcattagctttataccgaaaatacaatattcaatatttgatctaccagcatggcatcaaatgtgctctcgagctatgggatatgctcgaacacacggagcatctggaaatggctcaggagaagctggaggccttcaaaaaatttataacggaaagttataaccagtcaccggtgacaggtactacggtagctgtgctcacggagcatttgaaggaagacgaggagtttgtggtgagcagagagtgagctcga