Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C28C12.9   

sjj_C28C12.9 RNAi JA:C28C12.9
Simmer:C28C12.9
PCR_productsjj_C28C12.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C28C12.9b Source_evidenceePCR476WS150 Sequence/Annotation Release
C28C12.9c Source_evidenceePCR227WS150 Sequence/Annotation Release
Overlaps_Gene C28C12.9 Source_evidenceePCR1015WS150 Sequence/Annotation Release
Chunk_score Abs_score931
Max_abs_score931C28C12.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV84971438498334
Overlaps_transcript (5)
WB_DNA_textsjj_C28C12.91192aaccaccgctttagtgtgctcacaacacgtttgtgggatgtagatgttgcccacgtggcaatcgtggcgagacctatttgttctacatctgctccttcgtcaatgatggaaagtaatgtggtgacgtcacggaagagcttctcgtgtggaaaagacgcatcacttgcagcgactccaaccagttccagttgggcagatattacggcctggaacatggatatttaaactatttgaaacacaggtttttagaaattttacaaaagtgtaactatttagatctaaaaaataagatgtacctgcagaacatctctagtcataatagagagcaaagagttctcaatatccacgacaactgatagtccttcgtcgatcaatcctgacaagtagtacaacgaagactctagggcgtatacctgaaataattatttattgaaaatatagtggcaatagtgtaccttcagtgccaattcagtcacaatcctttgtgatctcgaatcgtccgctaaagttgtgcgatcattctgcctactcggagttcgattacaccaaatcgatagttctctaagtgctcttcgagccattccaattgtggcggctgcgaatggcattctaccactaccgaccagctccgatgcaatttcggaaccgtgtccgggtgttccaagtagatttttgtctgttaccaatgcagtgagctcgatgcgcccaacgtcaattcctttcagtccgattgtttcgtcacgtgtaaattgaatcttgtcggtggttcccagttcagcttcatcgagtagaaagcaggttttctctccgttgttctgaaaataaatgttaatttaaagagaacagaaattcctactaacatttccgaaaacgacgtaaaagttggcattgtgatgacccataactcggatgttctgaccatttaacattgattttccaccaggtccagctgtttgttcacagactcctccattcgtatcttttacaattgcaaccgctggtcgaagctttccagacccaagaattcctaaatacttggacttttgttcatcagatccataaattgtcaaaatgtttgcgacaagaagagaaatgtgtgaagttgtgtatacattccaatctacactgagttcttcgaaaactttcgacaaatccttattacacatgccgatgccgtcgaaatattttccaa