Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C29E4.4   

sjj_C29E4.4 RNAi (2)
PCR_productsjj_C29E4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29E4.4 Source_evidenceePCR1107WS150 Sequence/Annotation Release
Overlaps_Gene C29E4.4 (3)
Overlaps_transcriptC29E4.4 Source_evidenceePCR1107WS150 Sequence/Annotation Release
WB_DNA_textsjj_C29E4.41199atgcagcagtcttccgagatggtctgatgattctaatcggtggaactcatgaagagtctcaatctgttcacatgttcatggtctggatgagtgctaactggcaaacagagcaacccaccggagtagtttggtcagcaagagttccaatgaatgagcatcgcgcccttttttcgaagattgacgattcgatctactctaatctgacgttgtgtattcccaagaatactgcagagtcgaaaaaggctgatagaacagatggaatcattatcatcaatccctactttggtactacataacaaaattaatttaatttttgatgatatttttcagcggtatctctataccttccattcgatttggccaaaccgaaaaaaccggaaagtctataccgtcatgtttccattccaccccgagatcaacttctaggatatgcaatttgctcacaatatgtctatattatgatgctagaatccggtgtctctacaattcgtcttctaccacgtggatttgcagacagctcgatctatacacatgagcaagtcgtcgtaccatctctgtcagtaggcactgatgattggccaattttaagcgaactcttgtctgaaatggttgcatctggacttccgaagactccactttatcaatcattgcatcgggctttcgagcttttcgcagaaaaacatatggcagagtcggaagaggaattaaaggcgattatcaaaatgccagatcaggaaattgctcgtattgtttctcaatttctctacgcaataattgattattcggatgctgccaacaaaactgacactgaactccacgcgaagcgagtgttgacatccagaatcatgcttttcctgaagcatatgggagtgtatgaaagaatcataagctcacccctgggaatcagcagaggaggaatcttatcgctacgtgtcggaggaacaatgctgggagaagtaaaaatttacacttagaaaaataaacttattttctgaattttcaggtctccgaacgtgtcgctgcatcaacggccatatggacgtggaaaacttcaaacgaaacaaattctgcagttttcgacgcaatcatcgagaaagttttgagaattccagaagtccaggatttaggtctgaaagataaagatgctctattcggtcgatgtggactagttcatcatattcctgttgttgctgctcaac