Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30B5.1   

sjj_C30B5.1 RNAi JA:C30B5.1
Simmer:C30B5.1
PF:GL1_6D4
PCR_productsjj_C30B5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30B5.1 Source_evidenceePCR730WS150 Sequence/Annotation Release
Overlaps_Gene C30B5.1 (3)
Overlaps_transcriptC30B5.1 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30B5.1828ttgaaacacagcatggaagcgaatgctgagggcccatcgacgtgtagaattggtattagcagatctgaaagaaatagtgagtcattgcaatggattggtttgaagacatacgaagatagtacagatggattcgcaaagtgagatcttgtatgcaagttcttaaaaacattattaaatgtttcaggtccgtcaattctgaaggtgaacgtcagcaaggaataaatggtcaaattgacgatgaagtctttgaggatgaatcaagattcaaaccagtagcgtcaatgcaagatgtgatgaggacattgtctactccaagcacacttcgaccacctgtgtctccgcttatgaaatcattcagttcgatggacagctcaaacttcaagaatccaatcaacgctcatccaccaatgttcttctcggatccgcatttcctaatcaacaacaatcagttcaacagtccaacaccattctatgctctgaatagttatttcccttcattcccaatggattctagccaagtctatcagaatgctactgacgagcatttcacccctagcggagcatccgaagtggtctgcactgagcaaacgccaggccatcatttcacctacatacatccagactctggggttcgtctcaccgatccgtcagccttcttgacatcatttgtcccatctcctatcacgaaagttcctccaatcaattttaatgacgaaacgtcgaggtctcgttctgcctctgcggtaacttgtaataattattatttacagttcaaaattcattaaacattccagccatcaacttctgtttacaacactggcgagttcg